ID: 1145757846

View in Genome Browser
Species Human (GRCh38)
Location 17:27405770-27405792
Sequence ATGTCTGAATTGCCCTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145757846_1145757848 2 Left 1145757846 17:27405770-27405792 CCAAGCAAGGGCAATTCAGACAT No data
Right 1145757848 17:27405795-27405817 TTGGATCCAGAGCTCAAACAAGG No data
1145757846_1145757850 14 Left 1145757846 17:27405770-27405792 CCAAGCAAGGGCAATTCAGACAT No data
Right 1145757850 17:27405807-27405829 CTCAAACAAGGTCTTCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145757846 Original CRISPR ATGTCTGAATTGCCCTTGCT TGG (reversed) Intergenic
No off target data available for this crispr