ID: 1145759951

View in Genome Browser
Species Human (GRCh38)
Location 17:27420308-27420330
Sequence CACTGTCCCCATGGGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145759931_1145759951 22 Left 1145759931 17:27420263-27420285 CCCACCTGCCCCTGTTCACCCCC No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759939_1145759951 2 Left 1145759939 17:27420283-27420305 CCCATTTCCCTAGAGCTACAGCC No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759938_1145759951 3 Left 1145759938 17:27420282-27420304 CCCCATTTCCCTAGAGCTACAGC No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759941_1145759951 -5 Left 1145759941 17:27420290-27420312 CCCTAGAGCTACAGCCCTCACTG No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759937_1145759951 4 Left 1145759937 17:27420281-27420303 CCCCCATTTCCCTAGAGCTACAG No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759940_1145759951 1 Left 1145759940 17:27420284-27420306 CCATTTCCCTAGAGCTACAGCCC No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759935_1145759951 13 Left 1145759935 17:27420272-27420294 CCCTGTTCACCCCCATTTCCCTA No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759942_1145759951 -6 Left 1145759942 17:27420291-27420313 CCTAGAGCTACAGCCCTCACTGT No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759934_1145759951 14 Left 1145759934 17:27420271-27420293 CCCCTGTTCACCCCCATTTCCCT No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759933_1145759951 18 Left 1145759933 17:27420267-27420289 CCTGCCCCTGTTCACCCCCATTT No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759932_1145759951 21 Left 1145759932 17:27420264-27420286 CCACCTGCCCCTGTTCACCCCCA No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data
1145759936_1145759951 12 Left 1145759936 17:27420273-27420295 CCTGTTCACCCCCATTTCCCTAG No data
Right 1145759951 17:27420308-27420330 CACTGTCCCCATGGGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145759951 Original CRISPR CACTGTCCCCATGGGGAAGG GGG Intergenic
No off target data available for this crispr