ID: 1145760635

View in Genome Browser
Species Human (GRCh38)
Location 17:27423556-27423578
Sequence GATGAAGGAGTCGCTCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145760633_1145760635 -8 Left 1145760633 17:27423541-27423563 CCTGGAGACTTGGAGGATGAAGG No data
Right 1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG No data
1145760632_1145760635 -7 Left 1145760632 17:27423540-27423562 CCCTGGAGACTTGGAGGATGAAG No data
Right 1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG No data
1145760631_1145760635 -4 Left 1145760631 17:27423537-27423559 CCACCCTGGAGACTTGGAGGATG No data
Right 1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145760635 Original CRISPR GATGAAGGAGTCGCTCCAGA AGG Intergenic
No off target data available for this crispr