ID: 1145761253

View in Genome Browser
Species Human (GRCh38)
Location 17:27426414-27426436
Sequence GGACCTGGCCCTTCCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145761253_1145761259 11 Left 1145761253 17:27426414-27426436 CCCAGCCTGGAAGGGCCAGGTCC No data
Right 1145761259 17:27426448-27426470 CTTTCCCCACAGATCTCTCTCGG No data
1145761253_1145761260 12 Left 1145761253 17:27426414-27426436 CCCAGCCTGGAAGGGCCAGGTCC No data
Right 1145761260 17:27426449-27426471 TTTCCCCACAGATCTCTCTCGGG No data
1145761253_1145761264 30 Left 1145761253 17:27426414-27426436 CCCAGCCTGGAAGGGCCAGGTCC No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145761253 Original CRISPR GGACCTGGCCCTTCCAGGCT GGG (reversed) Intergenic