ID: 1145761254

View in Genome Browser
Species Human (GRCh38)
Location 17:27426415-27426437
Sequence AGGACCTGGCCCTTCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145761254_1145761265 30 Left 1145761254 17:27426415-27426437 CCAGCCTGGAAGGGCCAGGTCCT No data
Right 1145761265 17:27426468-27426490 CGGGCTCACCCCGTGCCTGTGGG No data
1145761254_1145761260 11 Left 1145761254 17:27426415-27426437 CCAGCCTGGAAGGGCCAGGTCCT No data
Right 1145761260 17:27426449-27426471 TTTCCCCACAGATCTCTCTCGGG No data
1145761254_1145761264 29 Left 1145761254 17:27426415-27426437 CCAGCCTGGAAGGGCCAGGTCCT No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761254_1145761259 10 Left 1145761254 17:27426415-27426437 CCAGCCTGGAAGGGCCAGGTCCT No data
Right 1145761259 17:27426448-27426470 CTTTCCCCACAGATCTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145761254 Original CRISPR AGGACCTGGCCCTTCCAGGC TGG (reversed) Intergenic