ID: 1145761255

View in Genome Browser
Species Human (GRCh38)
Location 17:27426419-27426441
Sequence TGAGAGGACCTGGCCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145761255_1145761260 7 Left 1145761255 17:27426419-27426441 CCTGGAAGGGCCAGGTCCTCTCA No data
Right 1145761260 17:27426449-27426471 TTTCCCCACAGATCTCTCTCGGG No data
1145761255_1145761265 26 Left 1145761255 17:27426419-27426441 CCTGGAAGGGCCAGGTCCTCTCA No data
Right 1145761265 17:27426468-27426490 CGGGCTCACCCCGTGCCTGTGGG No data
1145761255_1145761264 25 Left 1145761255 17:27426419-27426441 CCTGGAAGGGCCAGGTCCTCTCA No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761255_1145761259 6 Left 1145761255 17:27426419-27426441 CCTGGAAGGGCCAGGTCCTCTCA No data
Right 1145761259 17:27426448-27426470 CTTTCCCCACAGATCTCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145761255 Original CRISPR TGAGAGGACCTGGCCCTTCC AGG (reversed) Intergenic