ID: 1145761257

View in Genome Browser
Species Human (GRCh38)
Location 17:27426435-27426457
Sequence GTGGGGAAAGTAGGCATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145761257_1145761264 9 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761257_1145761265 10 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761265 17:27426468-27426490 CGGGCTCACCCCGTGCCTGTGGG No data
1145761257_1145761260 -9 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761260 17:27426449-27426471 TTTCCCCACAGATCTCTCTCGGG No data
1145761257_1145761259 -10 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761259 17:27426448-27426470 CTTTCCCCACAGATCTCTCTCGG No data
1145761257_1145761271 29 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761271 17:27426487-27426509 TGGGACATATATTTGCTGGAAGG 0: 1
1: 3
2: 2
3: 16
4: 146
1145761257_1145761270 25 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761270 17:27426483-27426505 CCTGTGGGACATATATTTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 102
1145761257_1145761272 30 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761272 17:27426488-27426510 GGGACATATATTTGCTGGAAGGG 0: 1
1: 1
2: 1
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145761257 Original CRISPR GTGGGGAAAGTAGGCATGAG AGG (reversed) Intergenic