ID: 1145761261

View in Genome Browser
Species Human (GRCh38)
Location 17:27426452-27426474
Sequence GAGCCCGAGAGAGATCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145761261_1145761272 13 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761272 17:27426488-27426510 GGGACATATATTTGCTGGAAGGG 0: 1
1: 1
2: 1
3: 11
4: 114
1145761261_1145761265 -7 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761265 17:27426468-27426490 CGGGCTCACCCCGTGCCTGTGGG No data
1145761261_1145761271 12 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761271 17:27426487-27426509 TGGGACATATATTTGCTGGAAGG 0: 1
1: 3
2: 2
3: 16
4: 146
1145761261_1145761270 8 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761270 17:27426483-27426505 CCTGTGGGACATATATTTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 102
1145761261_1145761264 -8 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761261_1145761273 14 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761273 17:27426489-27426511 GGACATATATTTGCTGGAAGGGG 0: 1
1: 1
2: 1
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145761261 Original CRISPR GAGCCCGAGAGAGATCTGTG GGG (reversed) Intergenic