ID: 1145761264

View in Genome Browser
Species Human (GRCh38)
Location 17:27426467-27426489
Sequence TCGGGCTCACCCCGTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145761263_1145761264 -10 Left 1145761263 17:27426454-27426476 CCACAGATCTCTCTCGGGCTCAC No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761255_1145761264 25 Left 1145761255 17:27426419-27426441 CCTGGAAGGGCCAGGTCCTCTCA No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761258_1145761264 0 Left 1145761258 17:27426444-27426466 CCTACTTTCCCCACAGATCTCTC No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761254_1145761264 29 Left 1145761254 17:27426415-27426437 CCAGCCTGGAAGGGCCAGGTCCT No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761261_1145761264 -8 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761253_1145761264 30 Left 1145761253 17:27426414-27426436 CCCAGCCTGGAAGGGCCAGGTCC No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761257_1145761264 9 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761256_1145761264 15 Left 1145761256 17:27426429-27426451 CCAGGTCCTCTCATGCCTACTTT No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data
1145761262_1145761264 -9 Left 1145761262 17:27426453-27426475 CCCACAGATCTCTCTCGGGCTCA No data
Right 1145761264 17:27426467-27426489 TCGGGCTCACCCCGTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145761264 Original CRISPR TCGGGCTCACCCCGTGCCTG TGG Intergenic