ID: 1145761272

View in Genome Browser
Species Human (GRCh38)
Location 17:27426488-27426510
Sequence GGGACATATATTTGCTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145761258_1145761272 21 Left 1145761258 17:27426444-27426466 CCTACTTTCCCCACAGATCTCTC No data
Right 1145761272 17:27426488-27426510 GGGACATATATTTGCTGGAAGGG 0: 1
1: 1
2: 1
3: 11
4: 114
1145761262_1145761272 12 Left 1145761262 17:27426453-27426475 CCCACAGATCTCTCTCGGGCTCA No data
Right 1145761272 17:27426488-27426510 GGGACATATATTTGCTGGAAGGG 0: 1
1: 1
2: 1
3: 11
4: 114
1145761263_1145761272 11 Left 1145761263 17:27426454-27426476 CCACAGATCTCTCTCGGGCTCAC No data
Right 1145761272 17:27426488-27426510 GGGACATATATTTGCTGGAAGGG 0: 1
1: 1
2: 1
3: 11
4: 114
1145761257_1145761272 30 Left 1145761257 17:27426435-27426457 CCTCTCATGCCTACTTTCCCCAC No data
Right 1145761272 17:27426488-27426510 GGGACATATATTTGCTGGAAGGG 0: 1
1: 1
2: 1
3: 11
4: 114
1145761261_1145761272 13 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761272 17:27426488-27426510 GGGACATATATTTGCTGGAAGGG 0: 1
1: 1
2: 1
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145761272 Original CRISPR GGGACATATATTTGCTGGAA GGG Intergenic