ID: 1145761273

View in Genome Browser
Species Human (GRCh38)
Location 17:27426489-27426511
Sequence GGACATATATTTGCTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145761266_1145761273 -10 Left 1145761266 17:27426476-27426498 CCCCGTGCCTGTGGGACATATAT 0: 1
1: 0
2: 1
3: 4
4: 86
Right 1145761273 17:27426489-27426511 GGACATATATTTGCTGGAAGGGG 0: 1
1: 1
2: 1
3: 14
4: 158
1145761262_1145761273 13 Left 1145761262 17:27426453-27426475 CCCACAGATCTCTCTCGGGCTCA No data
Right 1145761273 17:27426489-27426511 GGACATATATTTGCTGGAAGGGG 0: 1
1: 1
2: 1
3: 14
4: 158
1145761261_1145761273 14 Left 1145761261 17:27426452-27426474 CCCCACAGATCTCTCTCGGGCTC No data
Right 1145761273 17:27426489-27426511 GGACATATATTTGCTGGAAGGGG 0: 1
1: 1
2: 1
3: 14
4: 158
1145761258_1145761273 22 Left 1145761258 17:27426444-27426466 CCTACTTTCCCCACAGATCTCTC No data
Right 1145761273 17:27426489-27426511 GGACATATATTTGCTGGAAGGGG 0: 1
1: 1
2: 1
3: 14
4: 158
1145761263_1145761273 12 Left 1145761263 17:27426454-27426476 CCACAGATCTCTCTCGGGCTCAC No data
Right 1145761273 17:27426489-27426511 GGACATATATTTGCTGGAAGGGG 0: 1
1: 1
2: 1
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145761273 Original CRISPR GGACATATATTTGCTGGAAG GGG Intergenic