ID: 1145764865

View in Genome Browser
Species Human (GRCh38)
Location 17:27451633-27451655
Sequence GCGGTGGCCCAGGCCAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145764865_1145764872 2 Left 1145764865 17:27451633-27451655 CCCCACCTGGCCTGGGCCACCGC No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764865_1145764875 28 Left 1145764865 17:27451633-27451655 CCCCACCTGGCCTGGGCCACCGC No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145764865 Original CRISPR GCGGTGGCCCAGGCCAGGTG GGG (reversed) Intergenic
No off target data available for this crispr