ID: 1145764867

View in Genome Browser
Species Human (GRCh38)
Location 17:27451635-27451657
Sequence CTGCGGTGGCCCAGGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145764867_1145764875 26 Left 1145764867 17:27451635-27451657 CCACCTGGCCTGGGCCACCGCAG No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764867_1145764872 0 Left 1145764867 17:27451635-27451657 CCACCTGGCCTGGGCCACCGCAG No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145764867 Original CRISPR CTGCGGTGGCCCAGGCCAGG TGG (reversed) Intergenic