ID: 1145764870 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:27451649-27451671 |
Sequence | TGGTTTTGAGACAGCTGCGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1145764870_1145764875 | 12 | Left | 1145764870 | 17:27451649-27451671 | CCACCGCAGCTGTCTCAAAACCA | No data | ||
Right | 1145764875 | 17:27451684-27451706 | TGCCCTTGCCTCCCTACCATTGG | No data | ||||
1145764870_1145764881 | 24 | Left | 1145764870 | 17:27451649-27451671 | CCACCGCAGCTGTCTCAAAACCA | No data | ||
Right | 1145764881 | 17:27451696-27451718 | CCTACCATTGGCTCTCCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1145764870 | Original CRISPR | TGGTTTTGAGACAGCTGCGG TGG (reversed) | Intergenic | ||