ID: 1145764870

View in Genome Browser
Species Human (GRCh38)
Location 17:27451649-27451671
Sequence TGGTTTTGAGACAGCTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145764870_1145764875 12 Left 1145764870 17:27451649-27451671 CCACCGCAGCTGTCTCAAAACCA No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764870_1145764881 24 Left 1145764870 17:27451649-27451671 CCACCGCAGCTGTCTCAAAACCA No data
Right 1145764881 17:27451696-27451718 CCTACCATTGGCTCTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145764870 Original CRISPR TGGTTTTGAGACAGCTGCGG TGG (reversed) Intergenic