ID: 1145764872

View in Genome Browser
Species Human (GRCh38)
Location 17:27451658-27451680
Sequence CTGTCTCAAAACCAGAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145764865_1145764872 2 Left 1145764865 17:27451633-27451655 CCCCACCTGGCCTGGGCCACCGC No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764857_1145764872 27 Left 1145764857 17:27451608-27451630 CCTCCACTCTCACCCGGTTCCTG No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764858_1145764872 24 Left 1145764858 17:27451611-27451633 CCACTCTCACCCGGTTCCTGCTC No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764866_1145764872 1 Left 1145764866 17:27451634-27451656 CCCACCTGGCCTGGGCCACCGCA No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764859_1145764872 15 Left 1145764859 17:27451620-27451642 CCCGGTTCCTGCTCCCCACCTGG No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764867_1145764872 0 Left 1145764867 17:27451635-27451657 CCACCTGGCCTGGGCCACCGCAG No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764864_1145764872 8 Left 1145764864 17:27451627-27451649 CCTGCTCCCCACCTGGCCTGGGC No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764869_1145764872 -8 Left 1145764869 17:27451643-27451665 CCTGGGCCACCGCAGCTGTCTCA No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764868_1145764872 -3 Left 1145764868 17:27451638-27451660 CCTGGCCTGGGCCACCGCAGCTG No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data
1145764861_1145764872 14 Left 1145764861 17:27451621-27451643 CCGGTTCCTGCTCCCCACCTGGC No data
Right 1145764872 17:27451658-27451680 CTGTCTCAAAACCAGAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145764872 Original CRISPR CTGTCTCAAAACCAGAGCCA TGG Intergenic
No off target data available for this crispr