ID: 1145764873

View in Genome Browser
Species Human (GRCh38)
Location 17:27451669-27451691
Sequence CAAGGGCACAGCCATGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145764873_1145764883 14 Left 1145764873 17:27451669-27451691 CCAGAGCCATGGCTGTGCCCTTG No data
Right 1145764883 17:27451706-27451728 GCTCTCCATGTGGCAGCCTGAGG No data
1145764873_1145764875 -8 Left 1145764873 17:27451669-27451691 CCAGAGCCATGGCTGTGCCCTTG No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764873_1145764881 4 Left 1145764873 17:27451669-27451691 CCAGAGCCATGGCTGTGCCCTTG No data
Right 1145764881 17:27451696-27451718 CCTACCATTGGCTCTCCATGTGG No data
1145764873_1145764884 15 Left 1145764873 17:27451669-27451691 CCAGAGCCATGGCTGTGCCCTTG No data
Right 1145764884 17:27451707-27451729 CTCTCCATGTGGCAGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145764873 Original CRISPR CAAGGGCACAGCCATGGCTC TGG (reversed) Intergenic