ID: 1145764875

View in Genome Browser
Species Human (GRCh38)
Location 17:27451684-27451706
Sequence TGCCCTTGCCTCCCTACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145764865_1145764875 28 Left 1145764865 17:27451633-27451655 CCCCACCTGGCCTGGGCCACCGC No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764873_1145764875 -8 Left 1145764873 17:27451669-27451691 CCAGAGCCATGGCTGTGCCCTTG No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764870_1145764875 12 Left 1145764870 17:27451649-27451671 CCACCGCAGCTGTCTCAAAACCA No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764867_1145764875 26 Left 1145764867 17:27451635-27451657 CCACCTGGCCTGGGCCACCGCAG No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764871_1145764875 9 Left 1145764871 17:27451652-27451674 CCGCAGCTGTCTCAAAACCAGAG No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764869_1145764875 18 Left 1145764869 17:27451643-27451665 CCTGGGCCACCGCAGCTGTCTCA No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764866_1145764875 27 Left 1145764866 17:27451634-27451656 CCCACCTGGCCTGGGCCACCGCA No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data
1145764868_1145764875 23 Left 1145764868 17:27451638-27451660 CCTGGCCTGGGCCACCGCAGCTG No data
Right 1145764875 17:27451684-27451706 TGCCCTTGCCTCCCTACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145764875 Original CRISPR TGCCCTTGCCTCCCTACCAT TGG Intergenic
No off target data available for this crispr