ID: 1145768677

View in Genome Browser
Species Human (GRCh38)
Location 17:27477046-27477068
Sequence CTGTATGGTCTGAAAAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1480
Summary {0: 1, 1: 4, 2: 55, 3: 528, 4: 892}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145768677_1145768682 1 Left 1145768677 17:27477046-27477068 CCTCACCTTTTCAGACCATACAG 0: 1
1: 4
2: 55
3: 528
4: 892
Right 1145768682 17:27477070-27477092 GTAACTTCTTGACATTGCCATGG 0: 10
1: 261
2: 563
3: 859
4: 777
1145768677_1145768684 20 Left 1145768677 17:27477046-27477068 CCTCACCTTTTCAGACCATACAG 0: 1
1: 4
2: 55
3: 528
4: 892
Right 1145768684 17:27477089-27477111 ATGGTATATGTAAAGTGTCATGG 0: 1
1: 0
2: 70
3: 1094
4: 1157
1145768677_1145768686 29 Left 1145768677 17:27477046-27477068 CCTCACCTTTTCAGACCATACAG 0: 1
1: 4
2: 55
3: 528
4: 892
Right 1145768686 17:27477098-27477120 GTAAAGTGTCATGGCGCTGGTGG 0: 3
1: 231
2: 837
3: 899
4: 737
1145768677_1145768687 30 Left 1145768677 17:27477046-27477068 CCTCACCTTTTCAGACCATACAG 0: 1
1: 4
2: 55
3: 528
4: 892
Right 1145768687 17:27477099-27477121 TAAAGTGTCATGGCGCTGGTGGG 0: 3
1: 230
2: 890
3: 962
4: 765
1145768677_1145768685 26 Left 1145768677 17:27477046-27477068 CCTCACCTTTTCAGACCATACAG 0: 1
1: 4
2: 55
3: 528
4: 892
Right 1145768685 17:27477095-27477117 TATGTAAAGTGTCATGGCGCTGG 0: 1
1: 5
2: 254
3: 899
4: 874

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145768677 Original CRISPR CTGTATGGTCTGAAAAGGTG AGG (reversed) Intronic
900937371 1:5774962-5774984 CTGAATGGGATGAGAAGGTGGGG - Intergenic
901314449 1:8296553-8296575 CTTCATGGTCTAAAAAGGGGAGG - Intergenic
901384716 1:8900134-8900156 CTATATAGTCTAAAAAGGGGAGG - Intergenic
901392226 1:8954032-8954054 CTATGTGGTCTAAAAAGGGGAGG + Intronic
901495656 1:9620002-9620024 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
901807061 1:11745217-11745239 CTATATTGTCTAAAAAGGGGAGG - Intronic
902179755 1:14678899-14678921 CTGTAAGCTCCAAAAAGGTGAGG - Intronic
902193140 1:14777828-14777850 CTATATGGTCTAAAAAGGGGAGG - Intronic
902567302 1:17320546-17320568 CTATATGGTCTAAAAAGTGGAGG - Intronic
902947389 1:19851587-19851609 CTACATGGTCTAAAAAGGGGAGG - Intergenic
902978339 1:20105547-20105569 CTATATGCTCTAAAAAGGGGAGG + Intergenic
902978732 1:20108262-20108284 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
902998678 1:20248547-20248569 CTATATGGTCTAAAAAGGGGAGG + Intergenic
903150196 1:21402158-21402180 CTATATGGTCCTAAAAGGGGAGG + Intergenic
903206392 1:21785465-21785487 CTATATGGTCTAAAAAGGGGAGG - Intergenic
903207217 1:21791638-21791660 CTCTAAGGTCTAAAAAGGGGAGG - Intergenic
903456379 1:23490005-23490027 CTATAGGGTCTAAAAAGGGGAGG - Intergenic
903472524 1:23597298-23597320 CTATATGGTCTAAAAAAGGGAGG + Intronic
903899920 1:26636696-26636718 CTATATGGTCTAAAAAGGGGAGG + Intergenic
904526657 1:31138820-31138842 CGATATGGTCTAAAAAGGGGAGG - Intergenic
904583151 1:31562841-31562863 CTATAGGGTCTGAAAAGGGGAGG - Intergenic
905428506 1:37903368-37903390 CTATATGGTCTAAAATGGGGAGG + Intronic
905428952 1:37907781-37907803 CTATATGGTCTAAAAAGGGGAGG + Intronic
907414960 1:54307814-54307836 CTATATGGTCTAAAAAGGGGAGG + Intronic
907445221 1:54503311-54503333 CTATATGGTCTGAAAAGGGGAGG + Intergenic
907510198 1:54952317-54952339 CTATATGGTCTAAAAAGGGAAGG + Intergenic
908207561 1:61866908-61866930 CTATATGGTCTAAAAAGGGGAGG - Intronic
908217321 1:61966812-61966834 CTATATGGTCTAAAAAGGGAAGG - Intronic
908506126 1:64802041-64802063 CTATATGGTCTAAAAAGGGCAGG - Intronic
908582485 1:65530543-65530565 CAATATGGTCTAAAAAGGGGAGG - Intronic
908603119 1:65762874-65762896 CAGTATACTCTGAAAAGGTTAGG - Intergenic
909014308 1:70366714-70366736 CTATATGGTCTAAAAAGGAGAGG - Intronic
909070357 1:70986159-70986181 CTATATGGTCTAAAAAGGGGAGG + Intronic
909800053 1:79796107-79796129 CTATATGGTCTAAAAAGGGGAGG - Intergenic
910023571 1:82622730-82622752 CTATATGGTCTAAAAAAGGGAGG + Intergenic
910024014 1:82627295-82627317 CTATATGGTCTAAAAAGTAGAGG + Intergenic
910796166 1:91099761-91099783 CTATATGGTCTAAAAAGGGGAGG - Intergenic
910857065 1:91706505-91706527 CTATATGGTCTAAAAAGGGGAGG + Intronic
911153036 1:94613284-94613306 CTATATGGTCTAAAAAGGGGAGG + Intergenic
911572575 1:99535648-99535670 CTACATGGTCTAAAAAGGGGAGG - Intergenic
911576726 1:99586920-99586942 CTTTATGATCTAAAAAGGAGAGG - Intergenic
911951323 1:104177169-104177191 CTATATGGTCTAAAAAGAAGAGG + Intergenic
912124973 1:106524720-106524742 GTATATGGTCTCAAAAGGGGAGG - Intergenic
912134045 1:106637357-106637379 CAGTATGGTAAGAAATGGTGAGG + Intergenic
912388406 1:109284399-109284421 CTACATGGTCTAAAAAGGGGAGG + Intergenic
913097375 1:115531778-115531800 CTATATGGTCTAAGAAGGGGAGG + Intergenic
913134456 1:115874377-115874399 CTATATGGTCTAAAAAGGGGAGG - Intergenic
913405970 1:118490809-118490831 CTATATGGTCTAAAAAGGGGAGG - Intergenic
913471469 1:119191607-119191629 CTATATGTTCTAAAAAGGGGAGG - Intergenic
913669260 1:121080380-121080402 CTATATGGTCTAAAAAGAGGAGG - Intergenic
914021014 1:143867777-143867799 CTATATGGTCTAAAAAGAGGAGG - Intergenic
914442062 1:147716490-147716512 CTATATGGTCTAAAAAGAGGAGG - Intergenic
914442561 1:147720152-147720174 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
914659506 1:149775705-149775727 CTATATGGTCTAAAAAGAGGAGG - Intergenic
914817617 1:151074620-151074642 CTATATGGTCTAAAAAGAGGAGG - Intronic
915211721 1:154314407-154314429 CTATATGGTCTAAAAGGGGGAGG + Intergenic
915212181 1:154318656-154318678 CTATATGGTCTAAAAAGGGGAGG + Intergenic
915372886 1:155366288-155366310 CTATATGGTCTAAAAAGTGGAGG + Intronic
915558595 1:156673922-156673944 CTGGAGGGTCTGAGAAGGAGAGG + Intronic
915697102 1:157754376-157754398 CAATATGGTCTAAAAAGGGGAGG + Intronic
915806357 1:158857526-158857548 CTATATGGTCTAAAAAGGGGAGG + Intergenic
916259944 1:162831690-162831712 CTATATGGTATAAAAAGGGGAGG + Intronic
916408845 1:164524976-164524998 CTATATGGTCTAAAAAGAGGAGG + Intergenic
916622910 1:166520616-166520638 CTGTAAGGCCTGAAAATGTGTGG + Intergenic
916637852 1:166693081-166693103 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
916687643 1:167161758-167161780 CTATATGGTCTAAAAAGGGATGG + Intergenic
917071776 1:171159372-171159394 CTATATAGTCTAAAAAGGGGAGG + Intronic
917294008 1:173500133-173500155 CTATATGGTCTAAAAAGGAGAGG + Intergenic
917447526 1:175119261-175119283 CTATATGGTCTAAAAAGGGGAGG - Intronic
917566786 1:176220621-176220643 CTGGATGGTCTAAAAAGGGGAGG + Intergenic
917587946 1:176446809-176446831 CTCTCTGTTCTGAAAGGGTGAGG - Intergenic
917834485 1:178930501-178930523 CTATATGGTCTAAAAAGGGGAGG + Intergenic
917899386 1:179527179-179527201 CTATATGGTCTAAAAAGGGGAGG - Intronic
917962005 1:180153152-180153174 CAGTATGCTCTAAAAAGGAGAGG - Intergenic
918347807 1:183621683-183621705 CTATATGGTCTAAAAAGGGGAGG - Intergenic
918471654 1:184881706-184881728 CTACATGGTCTAAAAAGGGGAGG - Intronic
918589783 1:186228041-186228063 CTATATGGTCTAAAAAGGGGAGG + Intergenic
919092391 1:192991388-192991410 CTATATGGTCTAAAAAGGAGAGG + Intergenic
919634752 1:199992655-199992677 CTGTATTTTCTGTAAAGATGGGG + Intergenic
919966501 1:202532113-202532135 CTATATGGTCTAAAATGGGGAGG - Intronic
920030625 1:203035391-203035413 CTGTGTGTTAGGAAAAGGTGGGG + Intronic
920134176 1:203756107-203756129 CTATATGGTTTAAAAAGGAGAGG - Intergenic
920134986 1:203762448-203762470 CTATATGGTCTAAAAAGGGGAGG + Intergenic
920821224 1:209383214-209383236 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
921076874 1:211707027-211707049 CTATATGGTCTAAAAAGGGGAGG + Intergenic
921473976 1:215583314-215583336 CTATATGGTCTAAAAAGGGGAGG - Intronic
921529967 1:216269756-216269778 CTGCATGGTCCAAAATGGTGAGG - Intronic
921831304 1:219730772-219730794 CTATATGATCTAAAAAGGGGAGG + Intronic
921962808 1:221053842-221053864 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
922028564 1:221776692-221776714 CTGTATGATCTAAAATGGGGAGG - Intergenic
922084855 1:222336619-222336641 CTCTATGGGCTGAGAAGGGGAGG + Intergenic
922142766 1:222906670-222906692 CTATATGGTCTAAAAAGAGGAGG + Intronic
922190412 1:223313890-223313912 CCATATGGTCTAAAAAGGAGAGG + Intronic
922191318 1:223321035-223321057 CTCTTTGGTCTGGACAGGTGAGG - Intronic
922364282 1:224849587-224849609 CTATATGGTCTAAAAAGAGGAGG + Intergenic
922422044 1:225466709-225466731 CTATATGGTCTAAAAAGGGGAGG - Intergenic
922600802 1:226851220-226851242 CTATATGGTCTAAAAATGGGAGG + Intergenic
922811514 1:228417682-228417704 CTATATGGTCTAAGAAGGGGAGG - Intergenic
923019485 1:230151908-230151930 CTATATGGTCTAAAAAGGAGAGG - Intronic
923066198 1:230519451-230519473 CTATATGGTCTGAAAATGGGAGG + Intergenic
923090860 1:230740102-230740124 CTCTATAGTCTAAAAAGGAGAGG - Intergenic
923386665 1:233471872-233471894 CTATATGGTCTGAAAAGGGGAGG + Intergenic
923601828 1:235410375-235410397 CTACATGGTCTTAAAAGGGGAGG - Intronic
923673350 1:236060221-236060243 CTATATGGTCTAAAAAGGGGAGG - Intronic
923702607 1:236314512-236314534 CTATATGGTCTAGAAAGGGGAGG + Intergenic
924449143 1:244162137-244162159 CTATATGGTCAAAAAAGGGGAGG - Intergenic
924522973 1:244821490-244821512 CTATATAGTCTAAAAAGGAGAGG + Intergenic
924558396 1:245136873-245136895 CTATATGGTCTAAAAAGGGGAGG + Intergenic
924577058 1:245290492-245290514 CTACATGGTCTAAAAAGGGGAGG - Intronic
924647010 1:245887312-245887334 CTATATGGTCTAAAAAGGGGAGG + Intronic
924683955 1:246268350-246268372 CTATATGATCTAAAAAGGGGAGG + Intronic
924691676 1:246357406-246357428 CTATATGGTCAAAAAAGGGGAGG + Intronic
924808098 1:247377749-247377771 CTATATGGTCTAAAAAGGGGAGG - Intergenic
924864532 1:247963264-247963286 CTATATGGTCTGAAAAGGTGAGG - Intronic
1063028251 10:2204586-2204608 CTATATGGTCTAAAGAGGAGAGG + Intergenic
1063301569 10:4853946-4853968 CTATAGGGTCTAAAAAGGGGAGG + Intergenic
1063432792 10:6005673-6005695 CTATATGGTCTCAAAAGGGGAGG + Intergenic
1063472124 10:6296631-6296653 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1063751051 10:8947803-8947825 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1063751065 10:8947895-8947917 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1063853741 10:10223044-10223066 CTATATGGTCTGAAAAGAGAAGG - Intergenic
1064075476 10:12265280-12265302 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
1064098654 10:12443992-12444014 CTATATGGTCTAAAAAGGGGGGG - Intronic
1064098907 10:12446324-12446346 CTACATGGTCTAAAAAGGGGAGG - Intronic
1064210092 10:13354350-13354372 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1064217017 10:13409041-13409063 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1064329209 10:14378022-14378044 CTATATAGTCTAAAAAGGGGAGG + Intronic
1064332624 10:14407992-14408014 CTATATGGTCTAAAAAGGGGAGG + Intronic
1064334624 10:14427518-14427540 CTATATGGTCTAGAAAGGAGAGG + Intronic
1064536001 10:16358543-16358565 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1064570289 10:16685518-16685540 CTATATGGTCTAGAAAGGAGAGG - Intronic
1064699859 10:18007671-18007693 CCATATGGTCTAAAAAGGGGGGG - Intronic
1064952795 10:20872834-20872856 CTACATGGTCTAAAAAGGGGAGG + Intronic
1064994356 10:21283294-21283316 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1065029827 10:21574682-21574704 CTATATAGTCTAAAAAGGGGAGG - Intronic
1065173507 10:23054834-23054856 CTACATGGTCTAAAAAGGGGAGG - Intergenic
1065290292 10:24222940-24222962 CTATATGGTCTAAAAAGGGGAGG - Intronic
1065384783 10:25124135-25124157 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1065441907 10:25761810-25761832 GTATATGGTCTAAAAAGGGGAGG - Intergenic
1065487217 10:26247196-26247218 CTATATGGTCTAAAAAGGGGAGG - Intronic
1065493551 10:26306567-26306589 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1065578762 10:27150707-27150729 CTATGTGGTCTAAAAAGGGGAGG + Intronic
1065584052 10:27200340-27200362 CTATATGGTCTAAAAAGGGGAGG + Intronic
1065696599 10:28386293-28386315 CTATATGGTTTAAAAAGGGGAGG + Intergenic
1065889290 10:30107458-30107480 CTATATGATCTAAAAAGGGGAGG + Intronic
1066108889 10:32179209-32179231 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1066117397 10:32252863-32252885 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1066265916 10:33775458-33775480 CTATATGGTTTGAAAAGTGGAGG - Intergenic
1066268434 10:33798632-33798654 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1066282616 10:33932295-33932317 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1066386296 10:34944205-34944227 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1066387236 10:34951642-34951664 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1066640537 10:37550525-37550547 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1066646603 10:37616968-37616990 CAGCATGATCTGTAAAGGTGTGG - Intergenic
1067328376 10:45291616-45291638 CTATATGGTCTAAAAATGGGAGG - Intergenic
1067341698 10:45411066-45411088 CTATATGGTCTAAAAAAGGGAGG - Intronic
1067823297 10:49549811-49549833 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1067965669 10:50910061-50910083 TTTTATGGCCTGAAAAAGTGAGG + Intergenic
1068098369 10:52520692-52520714 CTATATGGTCTAAAAAGGAGAGG + Intergenic
1068505954 10:57899196-57899218 CTATATGTTCTAAAAAGGTGAGG - Intergenic
1069270247 10:66517561-66517583 CTATATGGTCTAAAAGGGGGAGG + Intronic
1069484300 10:68811498-68811520 CTATATGGTCTGAAAGGTGGAGG - Intergenic
1069953078 10:72032947-72032969 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1071011635 10:80947328-80947350 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1071013488 10:80967006-80967028 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1071331644 10:84566378-84566400 TTGTATGATCTGACAAGGGGAGG + Intergenic
1071392589 10:85190502-85190524 CTGTATGGTCTAAAAATGGGAGG - Intergenic
1072167706 10:92829947-92829969 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1072215381 10:93283299-93283321 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1072579821 10:96730998-96731020 CTAGATGGTCTAAAAAGGGGAGG + Intergenic
1072589561 10:96817092-96817114 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1072860937 10:99005815-99005837 CTGGATGGACTGAAAAGGAAGGG - Intronic
1073133040 10:101202905-101202927 CTATATGGTCTAAAAAGGAGAGG + Intergenic
1073186308 10:101617284-101617306 CTGCATTGTCTGTGAAGGTGGGG - Intronic
1073531502 10:104236676-104236698 CTAGATGGTCTAAAAAGGGGAGG + Intronic
1074417081 10:113276216-113276238 CTATATGGTCTAAAAAGGGGTGG - Intergenic
1074592781 10:114829291-114829313 CTATATAGTCTAAAAAGGGGAGG - Intronic
1074614267 10:115050868-115050890 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1074690104 10:115996803-115996825 CTACATGGTCTAAAAAGGGGAGG - Intergenic
1075124403 10:119688093-119688115 CTATATGGTCTCAAAAGGGGAGG - Intergenic
1075124577 10:119689456-119689478 CTATTTGGTCTCAAAAGGGGAGG + Intergenic
1075710503 10:124528118-124528140 CTGTGTGGGCTGAACAGGGGAGG + Intronic
1075840604 10:125499188-125499210 CTGTGAGGTATGAAGAGGTGGGG - Intergenic
1075928011 10:126269073-126269095 CTATATGGTCTAAAAAGGGGAGG - Intronic
1075961699 10:126572499-126572521 CTATATGGTCTAAAAAGGGGAGG - Intronic
1076167200 10:128292199-128292221 CTGTAGGCTCTGAAATGGTCAGG + Intergenic
1076682129 10:132178481-132178503 CTGTTTGGTTTGAAAATGTTTGG + Intronic
1076698011 10:132256404-132256426 CTGTCTGGTCTGAAATTGTCTGG + Intronic
1077313283 11:1902886-1902908 CTGTATGGCCTAAAAAGCAGGGG - Intergenic
1077859340 11:6160986-6161008 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1077873589 11:6283927-6283949 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1078422188 11:11221550-11221572 CTGTATGGCTTAAAAAGGGGCGG + Intergenic
1078704917 11:13734158-13734180 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1079002187 11:16767341-16767363 GTGTATGATCTGGAAAAGTGAGG + Intergenic
1079057099 11:17215795-17215817 CTGAGTGGTCTGGAAAGATGGGG - Intronic
1079162914 11:18011593-18011615 CTGTATAATCTGAAACTGTGGGG - Intronic
1079236132 11:18691962-18691984 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1079281190 11:19088644-19088666 CCCTATGGTCTAAAAAGGGGGGG - Intergenic
1079717935 11:23771631-23771653 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1080058138 11:27928727-27928749 CTGTATGGTCTAAAAAAGGGAGG - Intergenic
1080076221 11:28152930-28152952 CTATATGGTCTAAAAAGGGGAGG - Intronic
1080288635 11:30645221-30645243 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
1080665863 11:34335835-34335857 ATATATGCTCTCAAAAGGTGTGG - Intronic
1080806280 11:35657005-35657027 CTATATGGTCTAAAAAGGGTAGG - Intergenic
1080812820 11:35722546-35722568 CTATATGGTCTAAAAAGGGGAGG - Intronic
1080845930 11:36026785-36026807 CTATATGGTCTAAAATGGGGAGG + Intronic
1081003729 11:37707123-37707145 CTGCATTGCCTGATAAGGTGAGG - Intergenic
1081093575 11:38902447-38902469 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1081424153 11:42906625-42906647 CTGTATGGTCTAAAAAGGGAAGG - Intergenic
1081970372 11:47194264-47194286 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1082191472 11:49250695-49250717 CTATATGGTCTAAAAAGGTGTGG - Intergenic
1082992073 11:59215602-59215624 CTGTATAGTCTAAAAAGGAGAGG - Intergenic
1083001164 11:59292242-59292264 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1083025580 11:59547941-59547963 CTATATGGTCTAAAAAGATGAGG - Intergenic
1083286104 11:61660063-61660085 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1083360690 11:62105292-62105314 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1083390972 11:62349856-62349878 CTATGTGGTCTAAAAAGGGGAGG - Intronic
1083691807 11:64413912-64413934 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1083701827 11:64484485-64484507 CTTTATGGTCTGAAGAGGGGAGG - Intergenic
1084025556 11:66446521-66446543 CTATGTGGTCTAAAAAGGGGAGG - Intronic
1084109669 11:67005688-67005710 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1084193639 11:67510752-67510774 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1084711988 11:70849315-70849337 ATGGCTGGTCTAAAAAGGTGAGG + Intronic
1084878926 11:72155663-72155685 CTAAATGGTCTAAAAAGGAGAGG - Intergenic
1085182809 11:74550264-74550286 CTATATGGTCTAAAAAGGGAAGG + Intronic
1085184345 11:74562764-74562786 CTGTGTGGTCTAAAAAGGGGAGG - Intronic
1085590196 11:77753006-77753028 CTATATGGTCTAAAAATGAGAGG + Intronic
1085953306 11:81359457-81359479 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1085974311 11:81634477-81634499 CCATATGGTCTAAACAGGTGAGG + Intergenic
1085974913 11:81640812-81640834 CTATATGGTCTAAAAAGGGGTGG + Intergenic
1086081656 11:82909204-82909226 CTATATGGTCTAAAAGGGGGAGG - Intronic
1086541276 11:87915545-87915567 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1086572856 11:88305137-88305159 CTCTATGGTCTAAAAAGGGGAGG + Intronic
1086674654 11:89590322-89590344 CTGTATGGTCTAAAAAGGGGTGG + Intergenic
1086900597 11:92363308-92363330 CTGTATTGTTTGAAAAAATGAGG + Intronic
1086920602 11:92582054-92582076 CTATATGGTCTAAAAAAGGGCGG - Intronic
1087022990 11:93621922-93621944 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1087304724 11:96474806-96474828 CTATATGGTCTAAAAAGAGGAGG + Intronic
1087438557 11:98153624-98153646 CTATATGGTCTAAAAAGGGAAGG - Intergenic
1087475841 11:98633275-98633297 CTATACGGTCTAAAAAGGGGAGG + Intergenic
1087674224 11:101140392-101140414 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1087843035 11:102939784-102939806 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
1087991397 11:104748213-104748235 CTATATGGTCTAAAAAGGAGAGG + Intergenic
1088102523 11:106170955-106170977 CTATATGGTCTGAAAAGGAAAGG + Intergenic
1088207090 11:107404671-107404693 GTCTTTGGTCTGGAAAGGTGGGG - Intronic
1088212782 11:107474960-107474982 CTATATGGTCTAAAAAAGGGAGG - Intergenic
1088253487 11:107881608-107881630 CTATATGGTCTAAAAAGGGGAGG - Intronic
1088317109 11:108518953-108518975 CTATATGGGCTAAAAAGGGGAGG + Intronic
1088486725 11:110348021-110348043 CCATATGGTCTAAAAAGGGGAGG - Intergenic
1088581408 11:111320285-111320307 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1089312934 11:117571990-117572012 CTATATGGTCTAAAAAGGGGAGG + Intronic
1089486862 11:118853288-118853310 CTATATGGTCTCGAAAGGGGAGG - Intergenic
1089542954 11:119201545-119201567 CTGTATGGTGTAAAAAGGGGAGG + Intergenic
1089749610 11:120641540-120641562 CTATATGGTCTAAAAAGGGGAGG - Intronic
1089821015 11:121226281-121226303 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1089883491 11:121797111-121797133 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1090032458 11:123218835-123218857 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1090331260 11:125933948-125933970 CTATATGGTCTCAAAAGGCAAGG + Intergenic
1091241013 11:134052524-134052546 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1092367588 12:7889893-7889915 CTATATGCTCCGAAAAGGGGAGG - Intronic
1092740309 12:11622255-11622277 CTGTATGGTCTGTAAAGGGGAGG + Intergenic
1092781982 12:11995916-11995938 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1093091400 12:14924988-14925010 CTATATGGTCTGAAAAGGTGAGG + Intronic
1093170443 12:15853785-15853807 CTATATGGTCTAAAAAGGAGAGG - Intronic
1093179405 12:15950298-15950320 CTATATGGTCTAAAAAGGGGAGG - Intronic
1093401814 12:18754791-18754813 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1093461796 12:19413704-19413726 CAATATGGTCTAAAAAGGGGAGG - Intronic
1093520666 12:20046461-20046483 CTGTTTGGGCTGAGAAGGTGTGG + Intergenic
1093735276 12:22613882-22613904 CTATATGGTCTAAAAAAGGGAGG + Intergenic
1093977656 12:25440409-25440431 CTATATGGTCCTAAAAGGTCTGG - Intronic
1094074317 12:26456384-26456406 CTATGTGGTCTAAAAAGGGGAGG + Intronic
1094100059 12:26752544-26752566 CTATATGGTCTAAAAAGGGGAGG + Intronic
1094100487 12:26757078-26757100 CTATATGGTCTAAAAAGGGGAGG + Intronic
1094146172 12:27230679-27230701 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1094221703 12:28001011-28001033 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1094309489 12:29063055-29063077 ATGTATGGTATTTAAAGGTGAGG - Intergenic
1094614135 12:32021166-32021188 CAGCATGGTCTAAAAAGGAGAGG - Intergenic
1094715661 12:33012657-33012679 CTGGATGGTCTAAAAAGGGGAGG + Intergenic
1094746471 12:33349822-33349844 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1095159004 12:38893467-38893489 CTCTATGTTCTAAAAAGGGGAGG + Intronic
1095543820 12:43342016-43342038 CTACATGGTCTAAAAAGGGGAGG + Intergenic
1095799122 12:46253431-46253453 CTATATGGTCTAAAAAGGGGAGG - Intronic
1095939888 12:47719266-47719288 CTGAATGGTAAGAAAAAGTGGGG + Intronic
1096337278 12:50765835-50765857 CTATATGGTCTAAAAAGGGGAGG + Intronic
1096337956 12:50771906-50771928 CTGTATGGTTTAAAAAGGGGAGG + Intronic
1096509710 12:52120975-52120997 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
1097456456 12:59804352-59804374 CTATATGGTCTAAAAATGGGAGG - Intergenic
1097889381 12:64761656-64761678 CTCTCTGGTCTAAAAAGGGGAGG + Intergenic
1097963759 12:65557610-65557632 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1098228885 12:68352539-68352561 CTGTATGGCCTAAAAAGGGGAGG + Intergenic
1098437946 12:70488113-70488135 CAATATGGTCTAAAAAGGCGAGG - Intergenic
1098439223 12:70500340-70500362 CTACATGGTCTAAAAAGGGGAGG - Intergenic
1098535593 12:71590889-71590911 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1098579033 12:72076882-72076904 ATGTATTGACTGAAAAGGAGAGG + Intronic
1098640686 12:72835346-72835368 ATATATGGTCTAAAAAGGGGAGG - Intergenic
1098841976 12:75487961-75487983 CTGTATCGTCTAAAAAGGGAGGG - Intronic
1098858798 12:75684382-75684404 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1098976073 12:76903354-76903376 CTATATAGTCTAAAAAGGTGAGG + Intergenic
1099172027 12:79376363-79376385 CTATATGGTCTAAAAAGGGGAGG - Intronic
1099189317 12:79546553-79546575 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1099325503 12:81209819-81209841 CTATATGGTCTAAAAAGGGGAGG - Intronic
1099370926 12:81829039-81829061 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1099854316 12:88143925-88143947 CTATATAGTCTAAAAAGGGGAGG - Intronic
1100120363 12:91362818-91362840 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1100516371 12:95331972-95331994 CTATATGGTCTAGAAAGGGGAGG + Intergenic
1100727155 12:97420807-97420829 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1100829862 12:98508058-98508080 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1100978591 12:100146704-100146726 CTATATGATCTGAAAGGGGGAGG - Intergenic
1101044035 12:100786335-100786357 CTGTGAGGTAGGAAAAGGTGGGG + Intronic
1101203220 12:102458682-102458704 CTATAAGCTCTGCAAAGGTGAGG - Intronic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1101856037 12:108443883-108443905 CTACATGGTCTAAAAAGGGGAGG - Intergenic
1101921240 12:108934801-108934823 CTATATGGTCTAAAAAGGGAAGG + Intronic
1102074712 12:110050647-110050669 CTATATGGTCTAAAAGGGGGAGG + Intronic
1102100075 12:110271543-110271565 CCATATGGTCTAAAAAGGAGAGG - Intergenic
1102412772 12:112734722-112734744 CTATATGGTCTAAAAAGGAGAGG - Intronic
1102526184 12:113514092-113514114 CTATATGATCTAAAAAGGGGAGG + Intergenic
1102683197 12:114704339-114704361 CTGCCTGGTCTGCAAAAGTGGGG + Intergenic
1102873034 12:116428656-116428678 CTATCTGGTCTAAAAAGGGGAGG + Intergenic
1102890660 12:116556273-116556295 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1102957279 12:117066980-117067002 TAGTTTGGTGTGAAAAGGTGCGG - Intronic
1103044281 12:117722601-117722623 CTATATGGTCTAAAAAGAAGAGG + Intronic
1103056123 12:117822133-117822155 CTATATGATCTAAAAAGGGGAGG + Intronic
1103133981 12:118491758-118491780 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1103245875 12:119456713-119456735 CTACATGGTCTAAAAAGGGGAGG - Intronic
1103348696 12:120267819-120267841 CTGTGTGGTCTGGAAATGCGAGG + Intergenic
1103655437 12:122466821-122466843 CTATATGGTCTAAAACGGGGAGG - Intergenic
1103964666 12:124631208-124631230 CTATATGGTCTACAAAGGGGAGG + Intergenic
1104030599 12:125063400-125063422 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1104232978 12:126903300-126903322 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1104233207 12:126905303-126905325 CTATATGGAATAAAAAGGTGAGG - Intergenic
1104307637 12:127623849-127623871 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1104372824 12:128238319-128238341 CTATATGGTCTAAAAATGGGAGG + Intergenic
1104448226 12:128849946-128849968 CTATATGGTCTAAACAGGGGAGG - Intergenic
1104449302 12:128856115-128856137 CTATATGTTCTGGAAAGGGGAGG - Intronic
1104466651 12:128995807-128995829 CTATATGGTCTGAAAGGGGGAGG - Intergenic
1104475033 12:129064070-129064092 CGGTATGTTGTGAAAAGCTGGGG + Intergenic
1104671515 12:130683771-130683793 CTATATGGTCTAGAAAGGGGAGG + Intronic
1105392191 13:19990774-19990796 GTGTATTATCTGAAAAGATGAGG - Intronic
1106331786 13:28746138-28746160 CTATATGGTCCAAAAAGGGGAGG - Intergenic
1106663150 13:31823767-31823789 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1106927629 13:34630191-34630213 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1107020268 13:35744058-35744080 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1107104304 13:36626832-36626854 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1107127331 13:36859611-36859633 CTATATGGTCTAAAAAGGGGAGG + Intronic
1107174507 13:37384867-37384889 CAATATGGTCTAAAAAGGGGAGG + Intergenic
1107311841 13:39086756-39086778 ATATATGGTCTAAAAAGGGGAGG + Intergenic
1107375871 13:39803627-39803649 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1107540884 13:41388098-41388120 CTATATAGTCTGAAAAGGGGAGG - Intergenic
1107666884 13:42699859-42699881 CTATATGTTCTGAAATGGGGAGG - Intergenic
1107708655 13:43131623-43131645 CTATATGGTCTAAAAAGTGGAGG - Intergenic
1107831437 13:44376993-44377015 CTCTATGGCTGGAAAAGGTGGGG - Intronic
1108391470 13:49951805-49951827 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1108508275 13:51133008-51133030 CTATATGGTCTACAAAGGGGAGG + Intergenic
1108509214 13:51139740-51139762 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1108528371 13:51304842-51304864 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1108900866 13:55406553-55406575 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1109153750 13:58878102-58878124 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1109162385 13:58991782-58991804 CTATATTGTCTAAAAAGGGGAGG - Intergenic
1109652792 13:65352274-65352296 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1109791866 13:67259410-67259432 CTGTATGCCCTAAAAAGGTGGGG - Intergenic
1109827485 13:67741366-67741388 CTATATGGTCTAAAAAGGAGAGG + Intergenic
1109897981 13:68719395-68719417 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1110018858 13:70442986-70443008 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
1110046588 13:70840788-70840810 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1110264006 13:73518056-73518078 CTCTATGGTCTAAAAAGGAAAGG - Intergenic
1110784525 13:79508502-79508524 CTATGTGGTCTAAAAAGGGGAGG - Intronic
1110875990 13:80511268-80511290 CTATATGGTCTAAAAAGGAGAGG - Intergenic
1110887500 13:80657421-80657443 CTGTAAGGGCTGGTAAGGTGGGG + Intergenic
1111266664 13:85823975-85823997 CTATATGGTCTGAAAAGAGGGGG + Intergenic
1111562979 13:89977108-89977130 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1111564578 13:89998138-89998160 CTGTATAATCAGAAAATGTGGGG + Intergenic
1112255502 13:97826900-97826922 GTATATGGTCTAAAAAGGGGAGG + Intergenic
1112543671 13:100342892-100342914 CTGTATTGTTTGTAAAGATGGGG + Intronic
1112585908 13:100718544-100718566 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1112903793 13:104392134-104392156 CTATATGGTCTACAAAGGGGAGG - Intergenic
1113089825 13:106605418-106605440 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1113108383 13:106796020-106796042 CTATATGGTCTTAAAAGGGGAGG + Intergenic
1113174383 13:107545645-107545667 CAGCATGGTCTGAAAAGGTGAGG + Intronic
1113236171 13:108277715-108277737 CTATATGGTCTAAAAAGGGGAGG - Intronic
1113480088 13:110614442-110614464 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1113519067 13:110925459-110925481 CTATATGGTCTAAAAATGGGAGG + Intergenic
1113523822 13:110958468-110958490 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1114146464 14:19983203-19983225 TTATATGGTCTAAAAAGGGGAGG - Intergenic
1114344049 14:21777099-21777121 CTATACGGTCTAAAAAGGGGAGG + Intergenic
1114505498 14:23209120-23209142 TTATATGGTCTAAAAAGGGGAGG - Intronic
1114562640 14:23604312-23604334 CTGTATGGTCTAAAATGGGGAGG - Intergenic
1114584229 14:23795171-23795193 TTATATGGTCTAAAAAGGGGAGG - Intergenic
1114790282 14:25650225-25650247 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1115129851 14:30042234-30042256 CTGTGTGATCTAAAAAGGGGAGG + Intronic
1115147051 14:30238185-30238207 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1115315859 14:32024294-32024316 CTATATGGTCCAAAAAGGGGAGG + Intergenic
1115443139 14:33459053-33459075 CTATATGGTCTAAAAAGGGAAGG - Intronic
1115482408 14:33874280-33874302 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1115681484 14:35743753-35743775 TTGTATGCTTAGAAAAGGTGAGG - Intronic
1115917487 14:38331878-38331900 CTCTATGGTCTAAAAAGGAAAGG + Intergenic
1116329345 14:43576782-43576804 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1116329972 14:43583305-43583327 CTATATGGTCTAAACAGGGGAGG + Intergenic
1116556774 14:46321157-46321179 CTATATGGTCTAAAAATGGGAGG + Intergenic
1116949563 14:50866790-50866812 CTGTGTGGGCTGAAGAGGTCAGG - Intronic
1117660521 14:57999554-57999576 CTTTATGGTATGTGAAGGTGTGG - Intergenic
1117666162 14:58058537-58058559 CCGTATGCTCTAAAAAGGAGAGG - Intronic
1117956131 14:61124991-61125013 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1118118248 14:62806172-62806194 CAATATGGTCTAAAAAGGGGAGG + Intronic
1118175619 14:63437172-63437194 CTATATGGTCTAAAAGGGAGAGG + Intronic
1118303991 14:64639324-64639346 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1118399404 14:65365699-65365721 CTATAGGGTCTGAAAAGGGGAGG + Intergenic
1118399894 14:65369714-65369736 CTATATGGTCTAAAAGGGAGAGG + Intergenic
1118538143 14:66791557-66791579 CTATATGGTCTAAAAAAATGAGG - Intronic
1118578443 14:67268572-67268594 CTATATGGTCTAAAAAGGGGAGG - Intronic
1118699619 14:68420522-68420544 GTATATGGTCTAAAAAGGGGAGG - Intronic
1118865137 14:69697081-69697103 CTATATGGTCTGAAAAGGGGAGG - Intronic
1118947751 14:70403629-70403651 CTATATGGTCTAAAAAGGGGAGG + Intronic
1118949337 14:70419752-70419774 CTATATGGTCTGAAAAGGGAAGG + Intergenic
1118997924 14:70854073-70854095 CTATATGATCTAAAAAGGGGAGG + Intergenic
1119000311 14:70875901-70875923 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1119034688 14:71219596-71219618 CTATATGGCCTAAAAAGGGGAGG - Intergenic
1119069417 14:71567653-71567675 CTATATGGTCTAAAAAGGGGAGG - Intronic
1119069444 14:71567880-71567902 CTATATGGTCTAAAAAGGGGAGG - Intronic
1119221061 14:72907759-72907781 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1119252654 14:73170019-73170041 TTGTATGGTCTAAAAAGGGGAGG - Intronic
1119578510 14:75751976-75751998 CTACATGGTCTAAAAAGGAGAGG - Intronic
1119720018 14:76884207-76884229 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1119735694 14:76980414-76980436 CTATATGGTCTAAACAGGGGAGG + Intergenic
1119943757 14:78669709-78669731 CTATATGGTCTAAAAAGGAGAGG - Intronic
1120044322 14:79789584-79789606 CTATAAGGTCTAAAAAGGGGAGG - Intronic
1120361233 14:83505353-83505375 CTCTGTGGTCTAAAAAGGGGAGG - Intergenic
1120865869 14:89294744-89294766 CTATATGGTCTAAAAAGGGGAGG + Intronic
1120896914 14:89541517-89541539 CTATATGGTCTAAAAAGGGGAGG + Intronic
1120970202 14:90200686-90200708 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1121149439 14:91618115-91618137 CTATATAGTCTAAAAAGGGGAGG - Intronic
1121194098 14:92054515-92054537 CTATATGGTCTAAAAAGGGGAGG + Exonic
1121462183 14:94089367-94089389 CTATATGGTCTGAAAGGGGGAGG - Intronic
1121610502 14:95275493-95275515 CCATATGGTCTAAAAAGGGGAGG + Intronic
1121673505 14:95732437-95732459 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1121794016 14:96720876-96720898 TTATATGGTCTAAAAAGGGGAGG - Intergenic
1122141073 14:99663390-99663412 CTATATGGTCCAAAAAGGGGAGG - Intronic
1122173856 14:99901610-99901632 CTATATGGTCTAAAAAGGGGAGG - Intronic
1122174402 14:99906420-99906442 CTATATGCTCTAAAAAGGGGAGG - Intronic
1122547733 14:102533717-102533739 CTATATGGTCTAAAATGGGGAGG - Intergenic
1122551268 14:102551340-102551362 CTATATGGTCTGAAAAGGGGAGG + Intergenic
1122949348 14:105032760-105032782 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1123156611 14:106233386-106233408 CTGCATGGTCTACAAAGGAGGGG - Intergenic
1123760643 15:23429647-23429669 ATGTATGGTCTGTATATGTGTGG + Intergenic
1123899268 15:24859807-24859829 TTATATGGTCTAAAAAGGGGAGG - Intronic
1124032667 15:26025831-26025853 CTACATGGTCTAAAAAGGGGAGG - Intergenic
1124076997 15:26455649-26455671 CTATATAGTCTGAAAGGGGGAGG - Intergenic
1124824889 15:33084002-33084024 TTATATGGTCTAAAAAGGGGAGG + Intronic
1124958617 15:34377394-34377416 CTATATGGTCTAAAAACGGGAGG + Intergenic
1125097199 15:35868506-35868528 CTATATGGTCTATAAAGGGGAGG + Intergenic
1125630052 15:41139834-41139856 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1125689860 15:41587178-41587200 CTATATGGTCTAAAAAGGAGAGG + Intergenic
1126157822 15:45581846-45581868 CTATATGGTCCAAAAAGGGGAGG - Intergenic
1126260361 15:46682324-46682346 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1126520116 15:49583490-49583512 CTTTTTGGTCTAAAAAGGGGAGG + Intronic
1126701751 15:51373985-51374007 ATATATGATATGAAAAGGTGTGG - Intronic
1127026084 15:54808270-54808292 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1127078660 15:55353177-55353199 TTGTGTGCTTTGAAAAGGTGTGG - Intronic
1127130975 15:55863212-55863234 CATTATGGTCTTAAAAGTTGAGG - Intronic
1127212168 15:56784524-56784546 CTATATGGTCTAAAAAGGCGAGG + Intronic
1127344527 15:58080917-58080939 CTATATGGTCTAAAAAGGGGAGG - Intronic
1127506475 15:59602898-59602920 CTATATGGTCTAAAAGGGGGAGG - Intronic
1127888586 15:63226926-63226948 CTATATGGCCTAAAAAGGGGAGG - Intronic
1127949749 15:63793466-63793488 CTATATGGTCTAAAAGGGGGAGG + Intronic
1127949835 15:63794097-63794119 CTATATGGTCTAAAAAGGGGAGG + Intronic
1128148772 15:65348126-65348148 CTACATGGTCTAAAAAGGGGAGG + Intronic
1128277429 15:66365391-66365413 CTATATAGTCTAAAAAGGGGAGG + Intronic
1128342050 15:66829316-66829338 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1130074259 15:80675103-80675125 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1130308622 15:82733108-82733130 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1130583308 15:85158048-85158070 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
1131352120 15:91710467-91710489 CTATATGGTCTAAAAAAGGGAGG + Intergenic
1131365940 15:91839800-91839822 CTATAAGGTCTAAAAAGGGGAGG - Intergenic
1131376517 15:91928655-91928677 CTGTAAAGTATGAAATGGTGAGG + Intronic
1131551999 15:93365190-93365212 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1131626159 15:94123021-94123043 CTAAATGGTCTTAAAAGGGGAGG - Intergenic
1131771111 15:95738040-95738062 TTGTATAGTCAGAGAAGGTGAGG + Intergenic
1131782209 15:95871956-95871978 CTATATGGTCTGAAAGGGAGAGG - Intergenic
1132083834 15:98890447-98890469 CTATATGGTCTAAAATGGAGAGG + Intronic
1132524028 16:405438-405460 CTTTTTGGTCTGAAAAGCAGGGG - Intronic
1132716713 16:1293957-1293979 ATATATGGTCTAAAAAGGGGAGG - Intergenic
1133414202 16:5593657-5593679 GTATATGGTCTGAAAAGAAGAGG + Intergenic
1133493122 16:6291023-6291045 CTATATGGTCTAAAAAGGGGAGG - Intronic
1133493781 16:6297036-6297058 CTCTGTGGTCTAAAAAGGGGAGG - Intronic
1133580747 16:7142194-7142216 CTGTATGTTTTGTAAAGATGGGG + Intronic
1133882420 16:9795375-9795397 CTATATGGTCTAAAAAAGGGAGG + Intronic
1133945244 16:10342456-10342478 CTATATGGTCTAAAAAGGGGAGG + Intronic
1134000177 16:10776808-10776830 CTATATGGTCGAAAAAGGGGAGG - Intronic
1134095944 16:11418525-11418547 CTATATTGTCTAAAAAGGGGAGG + Intronic
1134236927 16:12473837-12473859 CTATATGGTCTGAAAAAGGGAGG + Intronic
1134255934 16:12611437-12611459 CTATATGGTCTAAAGAGGGGAGG + Intergenic
1134328746 16:13230829-13230851 CTATATGGTCGAAAAAGGCGAGG - Intronic
1134371772 16:13632671-13632693 CTATATGGTCTTCAAAGGAGAGG - Intergenic
1134381023 16:13725948-13725970 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1134583203 16:15389154-15389176 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1134605876 16:15570826-15570848 CTACATGGTCTAAAAAGGGGAGG - Intronic
1134800788 16:17082659-17082681 CTATATGGTCTGAAAGGGGGAGG - Intergenic
1134903692 16:17961124-17961146 CTATATGGTGTAAAAAGGGGTGG + Intergenic
1135068493 16:19332003-19332025 CTACATGGTCTAAAAAGGGGAGG + Intergenic
1135169715 16:20173146-20173168 CTACATGGTCTAAAAAGGGGAGG + Intergenic
1135169787 16:20173653-20173675 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1135314707 16:21434698-21434720 CTATATGGTCTAAAAAGAGGAGG + Intronic
1135367630 16:21866978-21867000 CTATATGGTCTAAAAAGAGGAGG + Intronic
1135444184 16:22504184-22504206 CTATATGGTCTAAAAAGAGGAGG - Intronic
1135654296 16:24234213-24234235 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1135779087 16:25283296-25283318 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1135820342 16:25679679-25679701 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1135838744 16:25854283-25854305 CTATATGGTCTAAAAAGGAAAGG - Intronic
1135959723 16:26985567-26985589 CTATATGGTCTAAACAGGGGAGG + Intergenic
1135980391 16:27142552-27142574 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1136084182 16:27872808-27872830 ATGTATGGTCTAAAAGGGGGAGG + Intronic
1136193080 16:28630223-28630245 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1136311372 16:29413380-29413402 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1136324819 16:29515173-29515195 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1136439504 16:30255158-30255180 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1136558271 16:31021978-31022000 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1136930903 16:34417161-34417183 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1136973670 16:34994647-34994669 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1137402345 16:48163828-48163850 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1137700561 16:50494992-50495014 CTATATGTTCTAAAAAGGGGAGG + Intergenic
1137937281 16:52646515-52646537 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
1138014905 16:53419534-53419556 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1138032321 16:53569507-53569529 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1138165164 16:54794473-54794495 CTATATGGTCTAAAAAGGAGAGG - Intergenic
1138247416 16:55478189-55478211 CTATATGGTCTAAAAAGGGGAGG - Intronic
1138453837 16:57109611-57109633 CTATATGGTCTAAAAAGGGGAGG - Intronic
1138469973 16:57226523-57226545 CTATATAGTCTAAAAAGGAGAGG - Intronic
1138684865 16:58716138-58716160 CACTATGGTCTGCAAAGATGCGG - Exonic
1138851657 16:60636516-60636538 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1138925954 16:61591502-61591524 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1138980297 16:62259608-62259630 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1139205380 16:65023676-65023698 ATATATGGTCTAAAAAGGGGTGG - Intronic
1139656474 16:68390095-68390117 TTATATGGTCTAAAAAGGAGAGG - Intronic
1139736826 16:68997428-68997450 CTATGTGGTCTAAAAAGGAGAGG - Intronic
1139854024 16:69966546-69966568 CTATATGGTCTAAAAATGGGAGG + Intergenic
1139858887 16:70004306-70004328 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1139883007 16:70189459-70189481 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1139886007 16:70207458-70207480 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1140016966 16:71196864-71196886 CTATATGGTCTAAAAAGGGGAGG + Intronic
1140017324 16:71200142-71200164 GTATATGGTCTAAAAAGGGGAGG + Intronic
1140281319 16:73557550-73557572 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1140335188 16:74098270-74098292 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1140369502 16:74406060-74406082 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1140499333 16:75419780-75419802 CTAAATGGTCTGAAAAGGGGAGG + Intronic
1140518203 16:75559799-75559821 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1140641417 16:76977756-76977778 CTATATGGTCTAAACAGGGGAGG + Intergenic
1140931924 16:79635760-79635782 CTGCGTGTCCTGAAAAGGTGTGG + Intergenic
1141223564 16:82093894-82093916 CTGTATGGTCTAAAAGGGGGAGG - Intronic
1141403403 16:83770664-83770686 CTCTATGATCTAAAAAGGGGAGG - Intronic
1141407426 16:83806919-83806941 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1141752903 16:85971087-85971109 CTATATGGTTTAAAAAGGGGAGG + Intergenic
1141915725 16:87095314-87095336 CTGTATGGTCTAAAAAGGGGAGG - Intronic
1142026532 16:87817184-87817206 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
1143120143 17:4601239-4601261 TTGTATTTTCTGTAAAGGTGAGG - Intronic
1143888006 17:10080288-10080310 CTATATGGTCTATAAAGGGGAGG + Intronic
1143902074 17:10181989-10182011 CTATATGGTCTGAAAGGGGAAGG + Intronic
1144014051 17:11176995-11177017 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1144016234 17:11199060-11199082 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1144060040 17:11575116-11575138 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1144288276 17:13800594-13800616 TTGTATGGTTTGTAAAGATGAGG + Intergenic
1144637828 17:16921885-16921907 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
1145114188 17:20193095-20193117 CTATATGGTCTAAAAAGGGGAGG - Intronic
1145768677 17:27477046-27477068 CTGTATGGTCTGAAAAGGTGAGG - Intronic
1146146070 17:30417749-30417771 CAGTATGGTCTGGAAAGGCGTGG - Intronic
1146291561 17:31611241-31611263 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1146295035 17:31642812-31642834 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1146642607 17:34552710-34552732 CTGTGTGGTCTGATATGGGGTGG - Intergenic
1146693456 17:34892370-34892392 CTGTGTTGAATGAAAAGGTGAGG - Intergenic
1146694873 17:34901089-34901111 CTACATGGTCTAAAAAGGGGAGG + Intergenic
1146876357 17:36415445-36415467 CTATATAGTCTAAAAAGGGGAGG - Intronic
1146915872 17:36678000-36678022 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1147063026 17:37897428-37897450 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1148652797 17:49261682-49261704 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1148814755 17:50319534-50319556 CTATACGGTCTAAAAAGGGGAGG - Intergenic
1148933898 17:51149339-51149361 CTATATGGTCTACAAAGGGGAGG - Intergenic
1149044022 17:52223663-52223685 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1150173490 17:63024340-63024362 CTATATGGTCTAAAAAGGAGAGG - Intronic
1150511689 17:65759169-65759191 CTATATTGTCTAAAAAGGGGAGG + Intronic
1150609399 17:66721559-66721581 CCGTATGGTCTAAAAAGGGAAGG - Intronic
1150844257 17:68639028-68639050 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1150906373 17:69342531-69342553 CTACATGGTCTAAAAAGGGGAGG - Intergenic
1150957228 17:69872565-69872587 CTATATGGTTTTAAAAGGGGAGG - Intergenic
1151014838 17:70542313-70542335 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1151159009 17:72149191-72149213 CTGTATGGTCTAAAAAGGAGAGG - Intergenic
1151224600 17:72639296-72639318 CTATATGGTCTAGAAAGGAGAGG - Intergenic
1151241574 17:72762423-72762445 CTATATGGTCTAAAAAGCAGAGG + Intronic
1151401655 17:73859656-73859678 CTATATGGTCTAGAAAGGGGAGG + Intergenic
1151402076 17:73862308-73862330 CTATATGGTCTAGAAAGGGGAGG - Intergenic
1151417871 17:73978346-73978368 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1151553463 17:74835114-74835136 CTGTTTGCTCTGAACAGATGGGG + Intronic
1151894635 17:76971767-76971789 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
1151911688 17:77087752-77087774 CTACATGGTCTAAAAAGGGGAGG - Intronic
1152147833 17:78579723-78579745 CTAGATGGTCTAAAAAGGGGAGG + Intergenic
1152208274 17:78988369-78988391 CTCTATGGTCTAAAAACGGGAGG + Intergenic
1153209006 18:2738254-2738276 CTTTATGGTCAGAAACGGTGTGG - Intronic
1153682198 18:7511353-7511375 CTATATGGTCTGAAAAGGGGAGG + Intergenic
1154155618 18:11941970-11941992 CTGTAGGGTCTAAAAAGGGGAGG + Intergenic
1154463576 18:14620778-14620800 TTATATGGTCTAAAAAGGGGAGG - Intergenic
1155286867 18:24298184-24298206 CTATATGGTCTAAAAAGGGGAGG + Intronic
1155452189 18:25975141-25975163 CTATACGGTCTAAAAAGGGGAGG + Intergenic
1155452355 18:25976329-25976351 CTATATGGTCTAAAAAGGGCAGG + Intergenic
1156561423 18:38129976-38129998 CTATATGGGCTAAAAAGGGGTGG - Intergenic
1156881561 18:42086707-42086729 CTATATGGTCTAAAAAGGGGAGG + Exonic
1157056400 18:44234191-44234213 CTATATGGTCTAAAAAGGAGAGG - Intergenic
1157356879 18:46943560-46943582 CAATATGGTCTAAAAAGGGGAGG + Intronic
1157654684 18:49373392-49373414 CTATATGGTCTAAAAAGGGGAGG - Intronic
1157792464 18:50544919-50544941 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1158291354 18:55948403-55948425 CTATATGGCCTGAAAAGGGGAGG + Intergenic
1158709846 18:59827788-59827810 CTATATAGTCTGAAAAGGGGAGG + Intergenic
1158734738 18:60066737-60066759 ATTTATGGTCTAAAAAGGAGAGG - Intergenic
1158796021 18:60847722-60847744 CTATATGGTCTGACAAGGAAGGG - Intergenic
1158863431 18:61615405-61615427 CTATATGGTCTAAAAAGTGGAGG + Intergenic
1158952555 18:62508282-62508304 CCGTATGGACTGAAATGGTTGGG + Intergenic
1158990468 18:62863601-62863623 CTATATGGTCTAAAAAGGGGAGG - Intronic
1159365169 18:67456100-67456122 CTGTGTGGTCTAAAAGGGGGAGG - Intergenic
1159438174 18:68445027-68445049 CTATATGGTCTAAAAAAGTTTGG + Intergenic
1159447225 18:68555894-68555916 CTATATGGTCTAAAAAAGGGAGG - Intergenic
1159638891 18:70840031-70840053 CTATATGGTCTTAAAAGGGGAGG - Intergenic
1159675987 18:71284843-71284865 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1159676085 18:71285928-71285950 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1159916096 18:74189127-74189149 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1160588430 18:79926112-79926134 CTATATGGTCTAAAAAGGGGAGG + Intronic
1161190844 19:2954565-2954587 TTATATGGTCTGAAAAGGGGAGG + Intergenic
1161433187 19:4246234-4246256 CTATATGGTCTAAAAAAGGGAGG + Intergenic
1161640499 19:5419659-5419681 CTCTATGGTCTAAAAAGGCGAGG + Intergenic
1161713096 19:5860990-5861012 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
1162072658 19:8163760-8163782 CTCTATGCTCTAAAAAGGGGAGG - Intronic
1163164396 19:15485418-15485440 CTATATGGTCTTAAAAGAGGAGG - Intronic
1163210978 19:15840064-15840086 ATATATGGTCTAAAAAGGGGAGG - Intergenic
1163211108 19:15841015-15841037 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1163357522 19:16823864-16823886 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1163357697 19:16825000-16825022 CTCTATGGTCTAAAAAGAGGAGG + Intergenic
1163434542 19:17287489-17287511 CTATATGGTCTAAAAAGGGGAGG + Exonic
1164043368 19:21512155-21512177 CTGTATGGTCTAAAAAGGGGAGG - Intronic
1164088324 19:21924458-21924480 CTATATGGTGTAAAAAGGGGAGG - Intergenic
1164191393 19:22920488-22920510 CTATATGGTCTAAAAAGGGAAGG - Intergenic
1164413833 19:28029304-28029326 CTAGATGGTCTAAAAAGGGGAGG + Intergenic
1164612802 19:29644391-29644413 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1164687504 19:30177506-30177528 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1164770462 19:30804479-30804501 CTATATCGTCTAAAAAGGGGAGG + Intergenic
1164843398 19:31411760-31411782 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1164942774 19:32264416-32264438 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1164947456 19:32308574-32308596 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1165122150 19:33567005-33567027 CTTTATGGTCTAAAAAGGGGAGG - Intergenic
1165127121 19:33606168-33606190 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1165131769 19:33637032-33637054 CTCTATGGTCTAAAAAGGGGAGG - Intronic
1165146469 19:33734267-33734289 CTATATGGTCTATAAAGGAGAGG + Intronic
1165146981 19:33737069-33737091 CTATATGGTTTAAAAAGGGGAGG + Intronic
1165181719 19:33977345-33977367 CTATATGGTCTAAAACGGGGAGG + Intergenic
1165187548 19:34035075-34035097 CTATATGGTCTAAAAAGGGAAGG - Intergenic
1165318129 19:35069128-35069150 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1166321285 19:42020761-42020783 CTATATGGTCTAAAAGGGGGAGG + Intronic
1166459171 19:42970935-42970957 TTATATGGTCTAAAAAGGGGAGG + Intronic
1166459690 19:42975358-42975380 CTATATGGACTAAAAAGGGGAGG - Intronic
1166476120 19:43126202-43126224 CTATGTGGTCTAAAAAGGGGAGG + Intronic
1166602412 19:44109099-44109121 CAGTATAGACTGAAAAGGTTTGG + Exonic
1166639920 19:44487531-44487553 CTCTATGGTCTAAAAAGGAGAGG + Intronic
1166652875 19:44587924-44587946 TTATATGGTCTAAAAAGGGGAGG - Intergenic
1166900634 19:46058931-46058953 CTATATAGTCTAAAAAGGGGAGG - Intronic
1167730367 19:51249938-51249960 CTATATGGTCTAAAAAGGGGAGG - Intronic
1167806180 19:51787423-51787445 CTATATGGTCTAAAAAGGGGAGG + Intronic
1168382736 19:55938094-55938116 CTATATGGTCTAAAAATGGGAGG + Intergenic
1168444494 19:56400172-56400194 TTGTCTGGTTTGAAAAAGTGAGG + Intronic
1168547788 19:57268023-57268045 CTATATGGTCTAAAAAGGAGAGG + Intergenic
1168549096 19:57278517-57278539 CTATGTGGTCTGAAAAGGGGAGG - Intergenic
1168606978 19:57767972-57767994 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1168667831 19:58217816-58217838 CTATATGGTCTAAAAAGGGGAGG + Intergenic
924984163 2:253542-253564 CTATATGGTCTAAAAAGGAGAGG + Intronic
925155365 2:1645029-1645051 CTGAATAGTTGGAAAAGGTGTGG - Intronic
925174801 2:1775249-1775271 CTATAGGGTCTGAAAAGGGGAGG - Intergenic
925437369 2:3851601-3851623 CTATATGGTCTAAAAAGGGGAGG - Intergenic
925980071 2:9169472-9169494 CTATATGGTCTAAAAGGGGGAGG - Intergenic
926072743 2:9912961-9912983 CTGTATGGAGTGAAAGAGTGAGG + Intronic
926245913 2:11122354-11122376 CTATATGGTCTAAAAAGGGCAGG - Intergenic
926414233 2:12633341-12633363 CTATATGGTCAAAAAAGGGGAGG - Intergenic
926796840 2:16626452-16626474 CTGTAAGGTGGGAGAAGGTGGGG - Intronic
926959768 2:18343316-18343338 CTATATGGTCTAAAAAGGGGAGG + Intronic
927347116 2:22057932-22057954 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
927397757 2:22673833-22673855 CTATATGGTCTAAAAAGGGGAGG + Intergenic
927408753 2:22801120-22801142 CTATATAGTCTAAAAAGGGGAGG - Intergenic
927531125 2:23802956-23802978 ATATATGGTCTGAAAAGCTTTGG - Intronic
927748447 2:25644056-25644078 CTAGATGGTCTAAAAAGGGGAGG + Intronic
927892573 2:26761410-26761432 CTACATGGTCTAAAAAGGGGAGG + Intergenic
927973499 2:27320907-27320929 CTGGATGGTCTGAAAAAGTCTGG + Intronic
929060342 2:37917704-37917726 CTATATGGTCTAAAAAGGGGAGG - Intergenic
929221424 2:39468482-39468504 TTGTATGGTCTAAAAAGGGGAGG + Intergenic
929548514 2:42874072-42874094 CTATATGGCCTAAAAAGGGGAGG - Intergenic
929550996 2:42891817-42891839 CTATATAGTCTTAAAAGGGGAGG - Intergenic
929694898 2:44106180-44106202 TTGTATTGTCTGAAAAGGGGAGG - Intergenic
929987807 2:46753788-46753810 TTACATGGTCTGAAAAGGGGAGG - Intronic
930117146 2:47727905-47727927 CTATATGGTCCAAAAAGGGGAGG - Intronic
930150170 2:48051265-48051287 CTATATGGTCTAAGAAGGGGAGG - Intergenic
930151231 2:48061813-48061835 CTATATGGTCTAAAAAGGGGAGG - Intergenic
930414855 2:51078370-51078392 CTATATGGTCTAAAAGGGAGAGG + Intergenic
930414862 2:51078414-51078436 CTGTATGGTCTAAAAGGGAGAGG + Intergenic
930510193 2:52334956-52334978 CTATATGGTCTAAAAAGGGGAGG + Intergenic
930576736 2:53159620-53159642 CTATATGGTCTAAAAAGGGAAGG + Intergenic
930673888 2:54179586-54179608 CTATATGGTCTAAAAAAGGGAGG - Intronic
930771429 2:55134056-55134078 ATATATGGTCTGAAAGGGAGAGG - Intergenic
930797528 2:55408609-55408631 CTATATGGTCTAAAAAGGGGAGG + Intronic
931018323 2:58012149-58012171 CTATATGGTCTAAAAAGGGGAGG + Intronic
931100265 2:58991536-58991558 CTATATGGTCTAAAAAGGGGAGG - Intergenic
931121198 2:59222039-59222061 CTCTATGGTCTGAAAGGTAGAGG - Intergenic
931386671 2:61804102-61804124 CTATATGGTCTAAAATGGGGAGG - Intergenic
931541662 2:63336004-63336026 CTATATGGTCTAAAAAGAGGAGG + Intronic
931724421 2:65095205-65095227 CTGTATGTTTTGCAAAGATGAGG + Intronic
931999558 2:67872144-67872166 ATTAATGGTCTGAAAACGTGGGG + Intergenic
932159882 2:69449887-69449909 CTATATAGTCTAAAAAGGAGAGG - Intergenic
932486760 2:72088816-72088838 CTATATGGTCTAAAAAAGGGAGG + Intergenic
932819283 2:74886002-74886024 CTATATGGTCTAAAAAGGGAAGG - Intronic
932823745 2:74922309-74922331 CTGGAAGCTCTGAGAAGGTGGGG - Intergenic
932845707 2:75134060-75134082 CTGCACGGTCTAAAAAGGGGAGG + Intronic
933228737 2:79781177-79781199 CTGTATGGTCTAAAAAGGGGAGG - Intronic
933427349 2:82129766-82129788 CTATATGGTCTAAAAAGGTGAGG + Intergenic
933457930 2:82540771-82540793 CTATATGGTCTAAAAAGGAAAGG - Intergenic
933473843 2:82763962-82763984 CTATACGGTCTAAAAAGGGGAGG + Intergenic
934888588 2:98046459-98046481 CTGTATGGTCTAATAAGGGGAGG + Intergenic
935095493 2:99940603-99940625 CTATATGGTCTAATAAGGGGAGG + Intronic
935248090 2:101236754-101236776 CTATATAGTCTAAAAAGGGGAGG + Intronic
935412908 2:102784733-102784755 CTATATGGTCTAAAAAGGGGAGG - Intronic
935472896 2:103480651-103480673 TTGTAAGGTCTAAAAAGGGGAGG - Intergenic
935637032 2:105256989-105257011 CTATATGGTCTAAAAACGGGAGG + Intergenic
935661169 2:105468169-105468191 CTATATGGTCTAAAAAGGGGAGG + Intergenic
935724717 2:106013464-106013486 CTATATGGTCTAAAAAGGGGAGG + Intergenic
935743121 2:106168342-106168364 CTATATGGTCTAAAAAGAGGAGG + Intronic
935886038 2:107620604-107620626 CCATATGGTCTAAAAAGGGGAGG + Intergenic
936429656 2:112451182-112451204 CTGCATGGTCTAAAAAGGGGAGG - Intergenic
936598970 2:113876936-113876958 CTGTTTGATGTGAAAAGGGGCGG - Intergenic
936617525 2:114063231-114063253 CTATATGGTCTGAAAGGAAGAGG - Intergenic
936696453 2:114955194-114955216 CTATATGGTCTAAAAAGGGGAGG - Intronic
936819151 2:116497632-116497654 CTATATGGTCTAAAAAGGAGAGG + Intergenic
937099533 2:119258118-119258140 CTATATGGTCTAAAAAGGTAAGG - Intronic
938092648 2:128443493-128443515 CTGAATGGTTTCAAAAGGGGAGG - Intergenic
938693480 2:133814255-133814277 CTACATGGTCTAAAAAGGGGAGG - Intergenic
938735254 2:134180061-134180083 CTATATGGTCTAAAAGGGAGAGG + Intronic
938781736 2:134590723-134590745 CTATATGGTCTAAAAAAGGGAGG - Intronic
938850780 2:135257020-135257042 CTATATGGTCTAAAAAGGGGAGG + Intronic
939286315 2:140135434-140135456 CAGTATGGTCTAGAAAGGGGAGG - Intergenic
939292240 2:140211574-140211596 TTTTATGGTCTAAAAAGGGGAGG - Intergenic
939500723 2:142980093-142980115 CTATATGGTCTAAAAAGGGGAGG - Intronic
940172699 2:150845876-150845898 CTATATGGTCTAAAAAGGGGAGG - Intergenic
940184856 2:150972549-150972571 CTTTATGGTCTAAAAAAGGGAGG - Intergenic
940197630 2:151113563-151113585 CTGTATAATCTGAAAGGGGGAGG + Intergenic
940209811 2:151244883-151244905 CTATATGGTCTAAAAAGGGGAGG - Intergenic
940287079 2:152043054-152043076 CTGTATGGTCTAAAAAAAGGAGG + Intronic
940320361 2:152370386-152370408 CTTGATGGTATTAAAAGGTGGGG - Intronic
940726255 2:157340110-157340132 CTATATGGTCTAAAAAGGGGAGG - Intergenic
941111300 2:161421144-161421166 TTTTATGGTCAGAAAACGTGGGG - Intronic
941286977 2:163626967-163626989 CTATATAGTCTAAAAAGGGGAGG + Intronic
941324944 2:164102851-164102873 CTTTATGGTCTGCAAATGTTGGG - Intergenic
941395082 2:164964131-164964153 CTATATGGTCTAAAAAGGGGAGG + Intergenic
941424490 2:165324996-165325018 TGGTTTGGTCTGAAAAGGTCTGG - Intronic
941584114 2:167335589-167335611 ATATATGGTCTAAAAAGGGGAGG - Intergenic
941742758 2:169053308-169053330 CTGAATGGTCTGAAGTGGTTTGG + Intergenic
941876780 2:170441671-170441693 CTATATGGTCTAAAAGGGGGAGG - Intronic
942062085 2:172236693-172236715 CTATATGGTCTATAAAGGGGAGG - Intergenic
942078884 2:172382101-172382123 CTATATGGCCTAAAAAGGGGAGG + Intergenic
942314572 2:174685598-174685620 CTATATGGCCTAAAAAGGGGAGG - Intergenic
942577831 2:177383548-177383570 CTGTATTTTCTGTAGAGGTGTGG + Intronic
942588962 2:177519966-177519988 CTATATGGTCTAAAAAGGGGAGG - Intronic
942755405 2:179335631-179335653 CTGTAGGGGTTGGAAAGGTGAGG + Intergenic
942870211 2:180725687-180725709 GTATATGGTCTAAAAAGGTGAGG - Intergenic
943730111 2:191293560-191293582 CTATATGATCTGAAAAGGGGAGG - Intronic
943895103 2:193347620-193347642 CTATATGGTCTAAAAAGGGGAGG - Intergenic
943991872 2:194706187-194706209 CCGTATGGTGTAAAAAGGGGAGG - Intergenic
944199019 2:197085657-197085679 CTATATGGTCTAAAAAGGGGAGG + Intronic
944476038 2:200107712-200107734 CTATATGGTCTGAAAAGGGGAGG - Intergenic
944987061 2:205189287-205189309 CTGTCTGAGGTGAAAAGGTGGGG - Intronic
945168666 2:206973152-206973174 CTACATGGTCTAAAAAGGGGAGG - Intergenic
945252132 2:207772630-207772652 CTGTATGGTCTAAGAGGGGGAGG + Intergenic
945255368 2:207798765-207798787 CTATATGGTCTAAAAAGGGGAGG + Intergenic
945382357 2:209156069-209156091 CTATATGGTCTAAAAAGGGGAGG + Intergenic
945399000 2:209356329-209356351 CTATATGGTCTAAAAAGGGGAGG + Intergenic
945409769 2:209494568-209494590 CTGTATGGTCTAAAAAGGTGAGG + Intronic
945908239 2:215618001-215618023 CTATATGGTCTAAAAAGGGGAGG - Intergenic
945985273 2:216348553-216348575 CTATGTGGTCTAAAAAGGGGAGG + Intronic
946016532 2:216608467-216608489 CTATTTGGTCTAAAAAGGGGAGG - Intergenic
946110274 2:217408861-217408883 CTATATGGTCTAAAAAGGGGAGG - Intronic
946114430 2:217448961-217448983 CTATATGGTCTAAAAATGGGAGG - Intronic
946462221 2:219878759-219878781 CTATATGGTCTAAAAAGGGGAGG + Intergenic
946781575 2:223197011-223197033 CAGTATGGTCTAAAAAGGGGAGG - Intronic
947039097 2:225894762-225894784 CTGTGTATTCTGAAAGGGTGAGG - Intergenic
947097259 2:226580274-226580296 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
947975826 2:234364954-234364976 CTATAAGGTCTAAAAAGGGGAGG + Intergenic
948019951 2:234723914-234723936 CTATATGGTCTAAAAAGGAAAGG - Intergenic
948094389 2:235321856-235321878 CTATATGGTCTAAAAAGGGGAGG + Intergenic
948308382 2:236967176-236967198 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1169001737 20:2172886-2172908 CTGTATGTTCTTACCAGGTGCGG + Intronic
1169044213 20:2523221-2523243 CTATATGGTCTAAAAAGGGGAGG + Intronic
1169286342 20:4310555-4310577 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1169579981 20:7010602-7010624 CTATATGGTCTATAAAGGGGAGG + Intergenic
1169635971 20:7692098-7692120 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1169670297 20:8092513-8092535 TTCTATTGTCTGAAAAGGTGAGG - Intergenic
1169749073 20:8973459-8973481 CTATATGGTCTAAAAAGAAGAGG + Intergenic
1169782043 20:9320243-9320265 CTATATAGTCTAAAAAGGGGAGG - Intronic
1170000355 20:11607900-11607922 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
1170415484 20:16134396-16134418 CTATATGGCCTAAAAAGGGGAGG - Intergenic
1170442428 20:16392145-16392167 CTGTATGGCCGGAAAGGCTGAGG - Intronic
1170635052 20:18096907-18096929 CTATATGATCTAAAAAGGGGAGG + Intergenic
1171135784 20:22693309-22693331 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1171171659 20:23020761-23020783 CCATATGGTCTAAAAAGGGGAGG + Intergenic
1171309032 20:24131252-24131274 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
1171327560 20:24308972-24308994 CTGTATGGTCTAAAAAGAGGAGG + Intergenic
1171363143 20:24604563-24604585 CTATATGGTCCAAAAAGGGGAGG + Intronic
1171441095 20:25163708-25163730 CTATATGGTCTAAAAACGGGAGG - Intergenic
1171962706 20:31506367-31506389 CTTTATGGTCTAAAAAGGGGAGG + Intergenic
1172035233 20:32005936-32005958 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1173200140 20:40948519-40948541 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1173357984 20:42313192-42313214 CTATATGGTCTAAAAAGGGGAGG + Intronic
1173492523 20:43494654-43494676 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1173661285 20:44735681-44735703 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1173731468 20:45331756-45331778 CTATATGGTCTAAAAAGGGGAGG + Intronic
1173906886 20:46635968-46635990 CTATATGGTCTAAAAAGGGGAGG + Intronic
1174102713 20:48139410-48139432 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1174122564 20:48277189-48277211 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
1174516115 20:51093674-51093696 CTATATGGTCTGAAAAGGGGAGG + Intergenic
1174608404 20:51778513-51778535 CTGTATGGTCTAAAAAGGGAAGG + Intergenic
1174670403 20:52302362-52302384 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
1174867450 20:54151218-54151240 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1175009449 20:55720400-55720422 CTATATGACCTGAAAGGGTGGGG - Intergenic
1175010435 20:55729077-55729099 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1175027601 20:55919103-55919125 CTATATGGTCAGAAAAGGGGAGG + Intergenic
1175057068 20:56208325-56208347 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1175059464 20:56228575-56228597 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1175137132 20:56832636-56832658 TTATATGGTCTAAAAAGGGGAGG - Intergenic
1175144300 20:56884182-56884204 CTATATGGTCTCAAAAGGGGAGG - Intergenic
1175150607 20:56931049-56931071 CTATACGGTCTAAAAAGGGGAGG - Intergenic
1175181468 20:57151084-57151106 CCATATGGTCTAAAAAGGAGAGG - Intergenic
1175357559 20:58380871-58380893 CTGTACAGTTTGAAAGGGTGGGG - Intergenic
1175444671 20:59011789-59011811 CTGTATGGTCTACAAAGCGGGGG - Intergenic
1176026657 20:62989410-62989432 CTATATGGTCCAAAAAGGGGAGG + Intergenic
1176072010 20:63232077-63232099 CTAGATGGTCTAAAAAGGGGAGG - Intergenic
1176291686 21:5048910-5048932 CTATATTGTCTAAAAAGGGGAGG - Intergenic
1176298978 21:5089611-5089633 CTGCACGGTCTAAAAAGGAGAGG + Intergenic
1176810949 21:13537594-13537616 TTTTATGGTCTAAAAAGGGGAGG + Intergenic
1177684206 21:24416395-24416417 CTATATGGTCTAACAAGGGGAGG + Intergenic
1177701216 21:24641654-24641676 CTATATGGTCTAAAAAGGAAAGG - Intergenic
1177799160 21:25810511-25810533 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1177842053 21:26245667-26245689 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1177851515 21:26354554-26354576 GTGTATGGTGTGGAAAGATGAGG + Intergenic
1178044026 21:28674211-28674233 CCATATGGTCTAAAAAGGGGAGG + Intergenic
1178171719 21:30048804-30048826 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1178179571 21:30144383-30144405 CTGTATAGTTTAAAAAGGGGAGG + Intergenic
1178436043 21:32559155-32559177 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1178469799 21:32882375-32882397 CTATATGGTCTAAGAAGGGGAGG - Intergenic
1178516651 21:33253742-33253764 CTACATGGTCTAAAAAGGGGAGG - Intronic
1178835621 21:36095052-36095074 CCATATGGTCTAAAAAGGGGAGG + Intergenic
1179255171 21:39709689-39709711 CTATATGGTCTAAAATGGGGAGG - Intergenic
1179268782 21:39831662-39831684 CTGAATGGTGTGAAGATGTGTGG - Intergenic
1179515613 21:41904278-41904300 CTACGTGGTCTGAAAAGGGGAGG + Intronic
1179674265 21:42971431-42971453 CTATATGGCCTAAAAAGGGGAGG + Intergenic
1179796017 21:43784138-43784160 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1179809264 21:43859853-43859875 CTATATGGTCTAAAAAAGGGAGG - Intergenic
1179858048 21:44172338-44172360 CTGCACGGTCTAAAAAGGAGAGG - Intergenic
1179865569 21:44214731-44214753 CTATATTGTCTAAAAAGGGGAGG + Intergenic
1179895007 21:44356843-44356865 CTGTATGGTCTGAAAGAAAGAGG - Intronic
1180935822 22:19624807-19624829 CTGTATGGTCTAAAAAAGGGAGG + Intergenic
1181641739 22:24204318-24204340 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1181953049 22:26568663-26568685 CTATATGGTCTAAAAAGGTGAGG + Intronic
1182066387 22:27434438-27434460 CTGTGAGCTCTGAAAGGGTGGGG - Intergenic
1182198560 22:28544835-28544857 CTATATGGTCTAAAAAGGGGAGG + Intronic
1182270964 22:29153048-29153070 CTATATGGTCTAAAAAGGGAAGG - Intronic
1182454658 22:30442457-30442479 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1182521461 22:30887061-30887083 CTCTATGGTCTAAAAAGGGGAGG - Intronic
1183000190 22:34850559-34850581 CTATATGGTCTATAAAGGGGAGG + Intergenic
1183113275 22:35669000-35669022 CTATATGGTCTCAAAAGGGGAGG + Intergenic
1183113770 22:35673746-35673768 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1183402561 22:37613245-37613267 CTGTATGGGCAGGAAAGATGCGG - Intronic
1183589617 22:38772323-38772345 CTATATGGTCTATAAAGGGGAGG + Intronic
1184167430 22:42738308-42738330 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1184323432 22:43762097-43762119 CTATGTGGTCTGAAAAGTTTCGG - Intronic
1184345945 22:43912872-43912894 CTATATGGTCTAAAAAAGGGGGG + Intergenic
1184896319 22:47409093-47409115 CCATATGGTCTAAAAAGGGGAGG + Intergenic
1185230314 22:49676945-49676967 CTGTGGGGTCTGCGAAGGTGAGG - Intergenic
1185422442 22:50742660-50742682 TTGGATGGTAAGAAAAGGTGGGG + Intronic
949281967 3:2356397-2356419 CTATACGGTCTAAAAAGGGGAGG - Intronic
949785190 3:7732962-7732984 CTATATGGTCTAAAAAGGGGAGG - Intronic
950511579 3:13431613-13431635 CTATATGGTCTAAAAAGGGGAGG - Intergenic
950781860 3:15399139-15399161 CTATATGGTCTAAAAGGGGGAGG + Intronic
950782471 3:15403873-15403895 CTTTATGATCTAAAAAGGGGAGG - Intronic
950851361 3:16064850-16064872 CTGAATGGTCTGAAGAGAAGAGG + Intergenic
951104510 3:18727451-18727473 CTGAATTATCTGAAAAGATGAGG + Intergenic
951304625 3:21043325-21043347 CTATATGGTCTGAAAATGGGAGG - Intergenic
951350380 3:21600113-21600135 CTATATGGTCTAAATAGGGGAGG + Intronic
951382458 3:22000436-22000458 CTATATGGTCTAAAAAGGGGAGG + Intronic
952123660 3:30274913-30274935 CTATGTGGTCTCAAAAGGGGAGG + Intergenic
952124250 3:30280841-30280863 CTATATGGTCTAAAAAGGGAAGG + Intergenic
952219572 3:31311793-31311815 CTGTATGGTCTAAAAGGCAGAGG - Intergenic
953427572 3:42807822-42807844 CTATATGGTCTAAAAAGGGGAGG - Intronic
953521613 3:43648526-43648548 CTGTATGGTCTAAAAAGGGGAGG - Intronic
953610137 3:44440865-44440887 CTATATGGTCTAAAAAGGAGAGG - Exonic
953684381 3:45064923-45064945 CTATATGATCTAAAAAGGGGAGG - Intergenic
953732240 3:45459819-45459841 AAGTAGGGTCTGAAAAGGTAAGG + Intronic
954079154 3:48202791-48202813 CTATATGGTCTAAAAAGGGGAGG + Intergenic
954484159 3:50830986-50831008 CTATATGGTTTAAAAAGGGGAGG - Intronic
954938061 3:54345035-54345057 CTATAGGGTCTAAAAAGGAGAGG + Intronic
955006965 3:54977965-54977987 CTATACGGTCTAAAAAGGAGAGG - Intronic
955380816 3:58436421-58436443 CTATATGGTCTAAAAAGGGGAGG - Intergenic
955381172 3:58439603-58439625 CTATATAGTCTAAAAAGGGGAGG - Intergenic
955416534 3:58697022-58697044 CTATATGGTCTAAAAAGTGGGGG + Intergenic
955454609 3:59105922-59105944 CTATATGGTCTAAAAAGGGGAGG + Intergenic
955515859 3:59725860-59725882 CTATAAGGTCTAAAAAGGGGAGG - Intergenic
955567283 3:60260953-60260975 CTATATGGTCTAAAAAGAGGAGG + Intronic
956414888 3:69015069-69015091 CTATATGGTCTTAAAAGGGGAGG + Intergenic
956708839 3:72022924-72022946 CTATATGGTCTAAAAAGGAAAGG - Intergenic
956907409 3:73781140-73781162 CTATATGGTCTAAAAAGGGGAGG + Intergenic
957218155 3:77348313-77348335 CTACATGGTCTAAAAAGGGGAGG - Intronic
957794640 3:84987795-84987817 CTGCATGGTCTGAAAAGTCGGGG - Intronic
957893043 3:86384390-86384412 CTATATGGTCTAAAAAGGGGAGG - Intergenic
958038377 3:88196064-88196086 CTATATGGTCTAACAAGGGGAGG - Intergenic
958723937 3:97880525-97880547 TTGTATGGTCTAAAAATGAGGGG + Intronic
958890459 3:99776844-99776866 CTATACGGTCTAAAAAGGGGAGG - Intronic
959649092 3:108734525-108734547 CTATATGGTCTGAAAGGAGGAGG + Intergenic
959681013 3:109096541-109096563 CTATATGGTCTAAAAATGGGAGG + Intronic
959872641 3:111346105-111346127 ATATATGGTCTAAAAAGGGGAGG - Intronic
959989546 3:112615840-112615862 CTATATGGTCTAAAAAGGAGAGG + Intronic
960254771 3:115500266-115500288 CTGAATGGTCTTTAAAGATGTGG - Intergenic
960384040 3:116998505-116998527 ATCTATGGTTTGAAAAGGTTAGG + Intronic
960386295 3:117025775-117025797 CTTTATGGTCTAAAAATGAGAGG + Intronic
960387132 3:117034047-117034069 CTATATAGTCTAAAAAGGTGAGG + Intronic
960515091 3:118594721-118594743 CTATATGGTCTAAAAAGGGGAGG + Intergenic
960571266 3:119187537-119187559 GTGGATGGTCTGAAATTGTGTGG + Intronic
960941804 3:122939815-122939837 CTCCATGGTTGGAAAAGGTGGGG - Intronic
961688683 3:128653023-128653045 CTATATGGTCTAAAAAGGGGAGG - Intronic
962095279 3:132286458-132286480 CTATATGGTCTAAAAAGGGGAGG + Intergenic
962159010 3:132979282-132979304 CTATATGGTCTAAAAAAGGGAGG + Intergenic
962255831 3:133869509-133869531 CAGGATGGTGTGAACAGGTGTGG + Intronic
962747749 3:138410113-138410135 CCATATGGTCTAAAAAGGAGAGG - Intergenic
962795626 3:138847302-138847324 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
963037466 3:141044888-141044910 CTATATGGTCTAAGAAGGAGAGG - Intergenic
963672741 3:148272204-148272226 CTATATGGTCTAAAAAGGGGAGG - Intergenic
963818875 3:149866042-149866064 CTATATGGTCTAAAAAGGGAAGG - Intronic
963818908 3:149866342-149866364 CCATATGGTCTAAAAAGGGGAGG - Intronic
964294539 3:155219050-155219072 CTATATGGTCTAAAAGGGGGAGG - Intergenic
964467472 3:157012124-157012146 GTGGATGGTCTGAGAAGGTATGG - Intronic
964680369 3:159331411-159331433 GTGTATGTACTGACAAGGTGAGG + Intronic
965149468 3:164951515-164951537 CTATAGGGTCTAAAAAGGGGAGG - Intergenic
965287260 3:166832654-166832676 CTATATGTTCTAAAAAGGGGAGG - Intergenic
965333085 3:167401554-167401576 CTATATGGTCTAAAAAGGGGAGG - Intergenic
965587803 3:170334510-170334532 CTATATGGTATAAAAAGGGGAGG - Intergenic
965588916 3:170343868-170343890 CTATATGGTCTAAAAAGGGGAGG - Intergenic
965642109 3:170839935-170839957 CTATGTGGTCTAAAAAGGGGAGG + Intronic
966502287 3:180656876-180656898 CTATATGGTCTAAAAGGGGGAGG + Intronic
966721627 3:183068438-183068460 CTATATGGTCTAAAAAGGGGAGG + Intronic
967243597 3:187465188-187465210 CTGTATAGACTAAAAAGGAGAGG + Intergenic
967485583 3:190026554-190026576 CTATATGGTCTAAAAAGCGGAGG + Intronic
967606131 3:191449386-191449408 CTATATGGTCTAAAAAGGGGAGG - Intergenic
967960828 3:194922521-194922543 CTTTATGATCTAAAAAGGGGAGG + Intergenic
968210262 3:196842884-196842906 CTGTATGGTCTAAAAAGGGGAGG - Intergenic
968846271 4:3043473-3043495 CTGTATGTTCTAAAAAGAGGAGG + Intergenic
969087955 4:4670445-4670467 CTATATGGTCTAAAAAGGGAAGG + Intergenic
969303545 4:6311546-6311568 CTATATGGTCTAGAAAGGGGAGG + Intergenic
969419631 4:7084717-7084739 CTATATGGTCTAGAAAGGGGAGG - Intergenic
970532351 4:16997510-16997532 CTATATGGCCTAAAAAGGAGGGG + Intergenic
970711765 4:18872030-18872052 CTATATGGTCTAAAAAGGGGAGG - Intergenic
970856929 4:20659816-20659838 GTATATGGTCTAAAAAGGGGAGG + Intergenic
970933831 4:21545205-21545227 CTACATGGTCTAAAAAGGGGAGG + Intronic
971005851 4:22373842-22373864 CTATATGGTCTAAAAAGGGGAGG + Intronic
971016493 4:22494309-22494331 CTATATGGTCTAAAAAGGGGAGG + Intronic
971413723 4:26402796-26402818 AGGTCTGGGCTGAAAAGGTGGGG - Intronic
971568082 4:28170728-28170750 ATGTTTGGTATGAAAAGGTAGGG - Intergenic
971850118 4:31974729-31974751 CTGTATAGTCTAAAATGGGGAGG + Intergenic
971998448 4:33996721-33996743 CTATATGGTCTAAAAAGGGGAGG + Intergenic
972204670 4:36757820-36757842 CTATATGGTCTGAAAAGGAGAGG - Intergenic
972353494 4:38259488-38259510 CTATATGGTCTAAAAAGGGGAGG - Intergenic
972467841 4:39374356-39374378 TTGTATGGTTTGAAGAGATGGGG + Intergenic
973681237 4:53322399-53322421 CTATATGGTCTACAAAGGAGAGG + Intronic
973708040 4:53599401-53599423 CTATATGGTCTAAAAAGGGGAGG + Intronic
973775680 4:54239187-54239209 CTATATGGTCTAAAAAGGGGAGG + Intronic
973795223 4:54418327-54418349 CTATATGGTCTAAAAAAGGGAGG - Intergenic
973883464 4:55297048-55297070 CTATATGGTCTAAAAAGTGGAGG + Intergenic
973904463 4:55514135-55514157 CAGTATGATGTGAAAAGGAGTGG + Intronic
973942569 4:55925464-55925486 CCATATGGTCTAAAAAGGGGAGG - Intergenic
974029046 4:56759479-56759501 CTATATGGTCTAAAAAGGGGAGG + Intergenic
974174082 4:58303944-58303966 TTATATGGTCTAAAAAGGAGAGG + Intergenic
974412161 4:61555796-61555818 CTATATGGTCTAAAAAGGGGAGG - Intronic
974585839 4:63875736-63875758 CTATATGGTCAAAAAAGGGGAGG + Intergenic
974878095 4:67721937-67721959 CTATATGGTCTAAAAAGGGGAGG - Intergenic
974923015 4:68265382-68265404 CCATATGGTCTAAAAAGGGGAGG + Intergenic
974974594 4:68874584-68874606 GGGTTTGGTCTGAAAAGGTGGGG - Intergenic
975043034 4:69768738-69768760 CTATATGGTCTAAAAAGGGGAGG + Intronic
975043539 4:69773821-69773843 CTATATGGTCTGAAAATGTGAGG + Intronic
975206310 4:71647748-71647770 CTATATGGTCTAAAAAGGGGAGG - Intergenic
975412188 4:74066424-74066446 CTGTATAGTCTGAATAGGGGTGG - Intergenic
975415050 4:74096358-74096380 CTGTATGGTCTAAAAAAGAGAGG - Intergenic
975755496 4:77567778-77567800 CTGTATGGTCTAAAGAGGGGAGG + Intronic
975774122 4:77765208-77765230 CTATATGGTCGAAAAAGGGGAGG + Intronic
976287289 4:83382995-83383017 CCATATGGCCTAAAAAGGTGAGG - Intergenic
976301841 4:83522714-83522736 CTATATGGTCTGAAAAGGGGAGG + Intronic
976515438 4:85959180-85959202 CTATATGGTCTAAAAAGGGGAGG - Intronic
976617536 4:87093620-87093642 GTGAATGGTCTGAAGAGGAGGGG + Intronic
976638377 4:87311148-87311170 CTATATGGCCTAAAAAGGGGAGG + Intronic
976644051 4:87368847-87368869 CTACATGGTCTAAAAAGGGGAGG + Intronic
976747150 4:88414638-88414660 CTATATGATCTAAAAAGGGGAGG - Intronic
976767188 4:88609934-88609956 CTACATGGTCTAAAAAGGGGAGG - Intronic
977590283 4:98818513-98818535 CTATATGGTCTAAGAAGGGGAGG + Intergenic
977592733 4:98844585-98844607 CTATATTGTCTAAAAAGGGGAGG - Intergenic
977615577 4:99084467-99084489 CTATATGGTCTAAAAGGGGGAGG + Intronic
977673846 4:99726354-99726376 CTATATGGTCTAAAAAGGGAAGG - Intergenic
977829263 4:101571184-101571206 CTATATGGTCTAAAAAGGGGAGG - Intronic
978942548 4:114454254-114454276 CTATATGGTCTAAAAATGGGAGG - Intergenic
979084850 4:116395267-116395289 CTATCTGGTCTAAAAAGGGGAGG - Intergenic
979361964 4:119775484-119775506 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
979488960 4:121302359-121302381 CTGTATGCTCTCAAAAAGTCTGG - Intergenic
980643163 4:135605214-135605236 CTATATGGTCTAAAAAAGGGAGG - Intergenic
980716397 4:136635968-136635990 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
980782466 4:137509695-137509717 CTATATGTTCTTAAAAGGGGAGG - Intergenic
980988158 4:139715655-139715677 CTATATGGTCTAAAAAGGGGAGG - Intronic
981052194 4:140320281-140320303 CTATATTGTCTAAAAAGGGGAGG + Intronic
981362850 4:143866988-143867010 CTATATGGTCTAAAAAGAGGAGG - Intergenic
981373576 4:143987788-143987810 CTATATGGTCTAAAAAGGGGAGG - Intergenic
981382677 4:144091059-144091081 CTTTATGGTCTAAAAAGGGGAGG - Intergenic
981464851 4:145056344-145056366 CTATATGGTCTAAAAAGGGGAGG + Intronic
981608348 4:146564628-146564650 CTGTATGGTCTAAAAAAGGGAGG + Intergenic
981861686 4:149363003-149363025 ACTTATGGTATGAAAAGGTGAGG - Intergenic
982056021 4:151549520-151549542 CTATATGGTGAGAAAAGGGGAGG + Intronic
982087279 4:151848574-151848596 CTCTGTAGCCTGAAAAGGTGGGG - Intergenic
982220234 4:153118325-153118347 CTATATGGTCTAAAAAGGGGAGG + Intergenic
982479178 4:155888099-155888121 CTAAATGGTCTAAAAAGGAGAGG - Intronic
982673692 4:158351196-158351218 TTATATGGTCTAAAAAGGGGAGG - Intronic
982748371 4:159130027-159130049 CTGTATGGTCTAAAATAGGGAGG - Intronic
983401212 4:167268483-167268505 CTATATAGTCTAAAAAGGGGTGG + Intergenic
983732987 4:171021026-171021048 CTATATGGTCTAAAAAGGGAAGG + Intergenic
983803276 4:171962563-171962585 ATGTTTGGTCTAAAAAGGGGAGG + Intronic
983878050 4:172899819-172899841 CTATATGGTCTAAAAAGGGGAGG - Intronic
983995363 4:174175598-174175620 CTATATGGTCTAAAAAGGGGAGG - Intergenic
984118058 4:175707008-175707030 CTACATGGTCTAAAAAGGGGAGG + Intronic
984441243 4:179773690-179773712 CTATATGGTCTAAAAAGGGGAGG + Intergenic
984441657 4:179778409-179778431 CTATATGGCCTAAAAAGGGGAGG + Intergenic
984507613 4:180639339-180639361 CTATATGGTCTAAAAAGGGGAGG - Intergenic
984601156 4:181728494-181728516 CTATATGGTCTAAAAAGGGGAGG - Intergenic
984650801 4:182268774-182268796 CTATATGGTCTAAAAAGGGGAGG + Intronic
984872521 4:184339579-184339601 CTATATGGCCTGAAAAGGGGAGG - Intergenic
985656130 5:1132262-1132284 CTCTATGGCCTAAAAAGGGGAGG + Intergenic
985820506 5:2156890-2156912 CTATATGGTCTAAAAAGGGGAGG + Intergenic
985908433 5:2860453-2860475 CTGTATAGGCTGATAATGTGAGG - Intergenic
986254918 5:6094374-6094396 ATGTATGGTCTAAAAAGGGGAGG + Intergenic
986968643 5:13305581-13305603 CTATATGGTCTAAAAAGGGGAGG - Intergenic
987165811 5:15196802-15196824 CTATATGGTCTAAAAAGGGGAGG - Intergenic
987318474 5:16746141-16746163 CTATATCGTCTAAAAAGGGGAGG - Intronic
987761337 5:22165888-22165910 CTATATGGTCTGTAAAGGGGAGG + Intronic
987858176 5:23448492-23448514 CAGTATGGTTTAAAAAGGGGAGG - Intergenic
988131338 5:27110517-27110539 CTATATGGTCTAAAAAGGGGAGG - Intronic
988182749 5:27818023-27818045 CTAGATGGTCTAAAAAGGGGAGG + Intergenic
988388507 5:30597712-30597734 CTATATAGTCTAAAAAGGGGAGG + Intergenic
988452989 5:31361995-31362017 CTATATGGTCTAAAAAGGGGAGG - Intergenic
989477362 5:41889801-41889823 CTATTTGGTCTAAAGAGGTGGGG + Intergenic
990018743 5:51099656-51099678 CTATATGGTCTAAAAAGGGAAGG + Intergenic
990070456 5:51776673-51776695 CTATATGGTATTAAAAGGGGAGG - Intergenic
990076834 5:51856389-51856411 CTATATGGTCTAAAATGGGGAGG - Intergenic
990270492 5:54132710-54132732 CTATATGGTCTAAAAAGGGGAGG - Intronic
990384781 5:55249758-55249780 CTATATGGTCTAAAAAGGGGAGG + Intergenic
990420281 5:55625221-55625243 CTATATGGTCTGAAAGGGGCAGG + Intergenic
990600159 5:57350413-57350435 CTCCATGGTCTAAAAAGGGGAGG - Intergenic
990636661 5:57735628-57735650 CTATATGTTCTAAAAAGGAGAGG + Intergenic
990692791 5:58382494-58382516 CTATATGGTCTAAAAGGGGGAGG + Intergenic
991083308 5:62624338-62624360 CTATATAGTCTAAAAAGGGGAGG - Intronic
991432606 5:66563772-66563794 CTATATGGTCTGAAAAGGGAAGG + Intergenic
991628380 5:68628584-68628606 CTATATGGTCTAAAAAGGGGAGG + Intergenic
991896129 5:71399356-71399378 CTATATGGTCTGTAAAGGGGAGG + Intergenic
992159740 5:73989688-73989710 CTATATGGTCTAAAAAGGGGAGG - Intergenic
992222370 5:74585641-74585663 CTATATGGTCTAGAAAGGGGAGG - Intergenic
992245349 5:74815870-74815892 CAATATGGTCTGAAAAGGGGAGG + Intronic
992371258 5:76146414-76146436 CTATATGGTCTAGAAAGGGGAGG - Intronic
992392266 5:76340165-76340187 CTATATGGTCTAAAAGGGGGAGG + Intronic
992440386 5:76792977-76792999 CTACATGGTCTAAAAAGGAGAGG - Intergenic
992447035 5:76843549-76843571 CTATATGGTCTAAAATGGGGAGG - Intergenic
992542522 5:77778916-77778938 CTATATGGTCTAAAAAGGAAAGG + Intronic
992865808 5:80956227-80956249 CAGTGTGGTCTAAAAAGGGGAGG - Intergenic
993108727 5:83629494-83629516 CTAAATGGTCTAAAAAGGGGAGG + Intergenic
993120224 5:83765713-83765735 CTATATGGTCTGAAAAGGTGAGG + Intergenic
993329023 5:86573297-86573319 CTATATGGTCTAAAAAGGAGAGG + Intergenic
993600476 5:89917818-89917840 TTATATGGTCTAAAAAGGGGAGG - Intergenic
993639149 5:90381190-90381212 CTATATGGTCTAAAAAGGGGAGG - Intergenic
993780472 5:92060652-92060674 CTATATGGTCTAAAAACGGGAGG + Intergenic
993939242 5:94039492-94039514 CTATATGGTCTAAAAAGGGGAGG + Intronic
993939838 5:94045165-94045187 CTATATGGTTTTAAAAGGGGAGG + Intronic
994082976 5:95728995-95729017 CTATATGGTCTAAAAAGCAGAGG + Intronic
994185332 5:96809046-96809068 CTATATGGTCTAAAAAGGGGAGG - Intergenic
994281551 5:97909464-97909486 CTATATGGTCTAAAATGGGGAGG - Intergenic
994520140 5:100823279-100823301 CTGTATGGTCTAAAAAGGGAAGG + Intronic
994912857 5:105935685-105935707 TTGTTTGGTCTGGAAAGATGCGG - Intergenic
995794771 5:115929794-115929816 CTATATGGTTTAAAAAGGGGAGG - Intergenic
996057223 5:118994763-118994785 CTGTGTGGTCTGAGAAGGGGAGG - Intergenic
996129721 5:119767845-119767867 CTGTATAATCTGGATAGGTGAGG + Intergenic
996293263 5:121879742-121879764 TTATATGGTCTAAAAAGGGGAGG - Intergenic
996367624 5:122719753-122719775 CTATATGGACTAAAAAGGGGAGG + Intergenic
996684847 5:126268898-126268920 TTATATGGTCTAAAAAGGGGAGG - Intergenic
996873085 5:128213570-128213592 CTGTTTGGCCTGAGTAGGTGTGG + Intergenic
997107735 5:131040390-131040412 CGTGATGGTCTTAAAAGGTGGGG + Intergenic
997341318 5:133147254-133147276 CTATATGGTCTAAAAAGGGGAGG + Intergenic
997463254 5:134070008-134070030 CTATACGGTCTAAAAAGGGGAGG + Intergenic
997478548 5:134164495-134164517 GTTTATGGTCTGAAGGGGTGGGG - Intronic
997485015 5:134223750-134223772 AAGCATGGTATGAAAAGGTGTGG - Intronic
997665051 5:135623943-135623965 CTGTAAGCTCTGTGAAGGTGAGG - Intergenic
998958204 5:147458380-147458402 CTAGATGGTCTAAAAAGGGGAGG + Intronic
999365300 5:151020047-151020069 CTGTAGGGACAGAGAAGGTGGGG - Intergenic
999584922 5:153079800-153079822 CTATATGGTCTAAAAAGGGGAGG + Intergenic
999620072 5:153463820-153463842 CTATATGGTCTGAAAAGGGAAGG - Intergenic
999956820 5:156711953-156711975 CTATGTGGTCTAAAAAGGGGAGG - Intronic
1000060944 5:157654841-157654863 CTATATGGTCTAAAAAGGGGAGG + Intronic
1000090511 5:157925939-157925961 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
1000095792 5:157969786-157969808 CTGCATGTTCTGCAAAGGTGGGG + Intergenic
1001070560 5:168581269-168581291 CTATATGGTCTGTAAAGGGGAGG + Intergenic
1001388778 5:171361591-171361613 CTATATGGTCTAAACAGGGGAGG + Intergenic
1001510248 5:172315671-172315693 CTATATGGTCTAAAAATGGGAGG + Intergenic
1001689837 5:173624813-173624835 CAGTATATTCTGAAAAGGTGGGG + Intergenic
1001903825 5:175454279-175454301 CTATATGGTCTAAAGAGGAGAGG - Intergenic
1003075473 6:2980291-2980313 TTATATGCTCTGAAAAGGGGAGG + Intergenic
1003473837 6:6462894-6462916 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1003787648 6:9504986-9505008 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1004041898 6:11987601-11987623 CTATATTGTCTGAAAAGGGAAGG - Intergenic
1004366878 6:15020264-15020286 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1004391172 6:15210920-15210942 CTACATGGTCTAAAAAGGGGAGG + Intergenic
1004418677 6:15448072-15448094 CTGTATTGTCTAAAAAGGGTAGG - Intronic
1004432879 6:15561997-15562019 CTGTATGGTCTGGAAAAGGGAGG + Intronic
1004850090 6:19690494-19690516 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1005019237 6:21401860-21401882 CTGTATGGTCTAAAAAGGGGAGG + Intergenic
1005449723 6:25961093-25961115 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1005650794 6:27883053-27883075 CTATATGGTCTAAAGAGGGGAGG + Intergenic
1005776973 6:29144337-29144359 CTGTATGTTCTAGAAAGGGGAGG + Intergenic
1005817089 6:29562320-29562342 CTATATGGTCTAAAAAGAGGAGG + Intronic
1006036294 6:31215410-31215432 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1006329197 6:33377555-33377577 CTATATGATCTAAAAAGGGGAGG - Intergenic
1007340652 6:41189229-41189251 TTATATGGTCTGAAAAGAGGAGG - Intergenic
1007353476 6:41292600-41292622 CTATATGGTCTAAAAAGGAGAGG - Intergenic
1007523591 6:42471314-42471336 CTGTATGCTCTAAAAAAGGGAGG + Intergenic
1008291581 6:49722269-49722291 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1008559516 6:52710048-52710070 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1009413710 6:63394468-63394490 CTGTATGGTTTAAAAGGGGGAGG + Intergenic
1009604361 6:65848150-65848172 CTTTATGGTCTAAAAAGAGGGGG - Intergenic
1010157513 6:72811994-72812016 CTATATGGTCTAAAAAGGGGAGG - Intronic
1010234612 6:73564940-73564962 CTATATGGTCTAGAAAGGGGAGG + Intergenic
1010446021 6:75949425-75949447 CTATATGGTCTAAAAAGGGGAGG + Intronic
1010583974 6:77634962-77634984 CCGTATGGTCTAAAAAGGAGAGG + Intergenic
1011292601 6:85792258-85792280 CTTTATGGTCTAAAAAGAAGAGG - Intergenic
1011753680 6:90478055-90478077 CTGCATTGTCTTAAGAGGTGGGG + Intergenic
1011929411 6:92691484-92691506 CTATATGGTCTAAAAAGGTGAGG + Intergenic
1013208296 6:107964459-107964481 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1013230205 6:108155702-108155724 CTGAATGTTCTTAGAAGGTGTGG + Intronic
1013473716 6:110488350-110488372 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1013497077 6:110708248-110708270 CTGCATGGTCTGGAACAGTGTGG - Intronic
1013500695 6:110747814-110747836 CTGAGTGGTCTGAAAAAGTCTGG - Intronic
1013657123 6:112257426-112257448 CTATATGGTCTAAAAAAGGGAGG + Intergenic
1013767953 6:113595705-113595727 GGGTAGGGTCTGAAAAGATGGGG + Intergenic
1014200276 6:118601721-118601743 CTATATGGTCTAAAAGGGGGAGG - Intronic
1014242973 6:119038577-119038599 CTATATGGTCTGAAAAGAGGAGG + Intronic
1014944595 6:127482023-127482045 CTATATGGTCTAAAAAGGGGAGG + Intronic
1015044465 6:128761088-128761110 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1015632631 6:135246777-135246799 CTATATGGTCTAAAAAAGGGAGG - Intergenic
1015696951 6:135991010-135991032 CTATATGGTCTAAAAAGGGGAGG - Intronic
1016006319 6:139092533-139092555 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1016012869 6:139157120-139157142 CTATATGGTCTAAAAAGGGGAGG - Intronic
1016108798 6:140195259-140195281 CTATATGGTTTAAAAAGGGGAGG + Intergenic
1016207874 6:141491453-141491475 CTATATGGTCTACAAAGGGGAGG + Intergenic
1016406855 6:143740140-143740162 CTATACGGTCTAAAAAGGGGAGG - Intronic
1016513871 6:144872383-144872405 CTGTATGATCTAAAAGGGGGAGG - Intergenic
1016686413 6:146887327-146887349 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1016733342 6:147449493-147449515 CTATATGGTCTAAAAAGGGAAGG - Intergenic
1017348817 6:153415663-153415685 CTATATGATCTAAAAAGGGGAGG - Intergenic
1017404479 6:154103707-154103729 CTGTATGGTCTAAAAAGGGGAGG - Intronic
1017993664 6:159511638-159511660 CTATATGATCTAAAAAGGGGAGG - Intergenic
1018078602 6:160239228-160239250 CTATATAGTCTGAAAAGGGGAGG + Intronic
1018357263 6:163030735-163030757 CTATATGGTCTGAAAGGGGGAGG - Intronic
1018357642 6:163034992-163035014 CTATATGGTTTGAAAGGGGGAGG - Intronic
1018454656 6:163941203-163941225 CTATATGGCCTAAAAAGGGGAGG + Intergenic
1018494799 6:164338144-164338166 CTATATGGTCCGAAAAGGGGAGG + Intergenic
1018691025 6:166344197-166344219 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1018792734 6:167161919-167161941 CCATATGGTCTAAAAAGGGGAGG - Intronic
1018835638 6:167481448-167481470 CAATGTGGTCTGAAAAGGGGAGG - Intergenic
1019546069 7:1577004-1577026 CAACATGGTCTAAAAAGGTGAGG - Intergenic
1019586045 7:1804187-1804209 CTCTATGGTCTAAAAAGGAGAGG - Intergenic
1019791430 7:3016448-3016470 AAGTATGGTCTAAAAAGGGGAGG + Intronic
1019810156 7:3159225-3159247 CTATATGGTCTAAAAGGGAGAGG - Intronic
1019823032 7:3260135-3260157 CTGTATGGTCTAAAAGGGGGAGG + Intergenic
1019946552 7:4334100-4334122 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1019951464 7:4376451-4376473 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1020802397 7:12747976-12747998 CAATATGGTCTGAAAAGGGGAGG - Intergenic
1020804578 7:12772741-12772763 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1020996211 7:15268723-15268745 ATATATGATCTGCAAAGGTGGGG + Intronic
1021386689 7:20039548-20039570 CTATATGGTCTAAACAGGGGAGG - Intergenic
1022024158 7:26430300-26430322 ATGTGTGGTGTGCAAAGGTGAGG - Intergenic
1022272754 7:28826261-28826283 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1022356468 7:29619740-29619762 CTATATGGTCTGAAAAGGGGAGG - Intergenic
1022478642 7:30728441-30728463 CTATATGGTCTAAAAATGGGAGG + Intronic
1022747261 7:33184989-33185011 TTGTATGGTCTAAAGAGGGGAGG - Intronic
1022921094 7:35015564-35015586 CTGTATGGTCTGAAAGAGGGAGG + Intronic
1022922403 7:35028835-35028857 CTATATGGTCTAAAAAGGGGAGG - Intronic
1023046817 7:36217282-36217304 CTACATGGTCTAAAAAGGGGAGG - Intronic
1023049436 7:36238069-36238091 CTATATGGTCTAAAAAGGAGAGG - Intronic
1023514903 7:40992205-40992227 CTATATGGTCTAAAAAGCGGAGG - Intergenic
1023640129 7:42249186-42249208 CTGTATGGCCTGAAAAGTTGTGG - Intergenic
1024484801 7:49905958-49905980 TTATATGGTCTAAAAAGGGGAGG + Intronic
1024601465 7:50985325-50985347 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1024705823 7:51958857-51958879 CTATATGGTCTAAAAAGGGAAGG - Intergenic
1024768560 7:52690206-52690228 TTATATGGTCTAAAAAGGAGAGG + Intergenic
1024932571 7:54679252-54679274 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1025246832 7:57323906-57323928 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1025768533 7:64481989-64482011 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1025769221 7:64488526-64488548 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1026084855 7:67254656-67254678 CTATAGGGTCTAAAAAGGGGAGG - Intergenic
1026142776 7:67720483-67720505 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1026166480 7:67914574-67914596 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1026227561 7:68456082-68456104 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1026253757 7:68692945-68692967 CTATACGGTCTAAAAAGGGGAGG + Intergenic
1026274381 7:68863896-68863918 CTGTATGGTCTAAAAGGGGGAGG - Intergenic
1026288379 7:68984048-68984070 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1026490545 7:70859441-70859463 CTATATGGTCTAAAAAGGGAAGG - Intergenic
1026561932 7:71457598-71457620 CTATATGGTGTAAAAAGGGGAGG - Intronic
1026562333 7:71460761-71460783 CTATATGGCCTAAAAAGGGGAGG - Intronic
1026562708 7:71463699-71463721 CTATGTGGTCTAAAAAGGGGAGG - Intronic
1026583322 7:71635780-71635802 CTATATGGTCTAAAAAGGGGAGG - Intronic
1026583624 7:71638073-71638095 CTCTATGGTGTAAAAAGGGGAGG - Intronic
1026631089 7:72038813-72038835 CTATAGGGTCTAAAAAGGGGAGG + Intronic
1026692318 7:72560264-72560286 CTATAGGGTCTAAAAAGGGGAGG + Intronic
1026800120 7:73395016-73395038 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1026918890 7:74140546-74140568 CTATATTGTCTAAAAAGGGGAGG + Intergenic
1026921692 7:74160375-74160397 CTATACGGTCTAAAAAGGGGAGG + Intergenic
1027259518 7:76454769-76454791 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
1027282960 7:76622115-76622137 CTATGTGGTCTAAAAAGGGGAGG + Intronic
1027310888 7:76952853-76952875 CTATGTGGTCTAAAAAGGGGAGG - Intergenic
1027365012 7:77448213-77448235 CTATATGGTCTGAAAAGGGGAGG - Intergenic
1027796145 7:82696088-82696110 CTGTATGGTCTAAAAAAGGGAGG + Intergenic
1027951416 7:84821795-84821817 CTGTATGCTCTAAAAATGAGAGG - Intergenic
1027958472 7:84913370-84913392 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1028165377 7:87532582-87532604 CTATATGGTCTAAAAATGGGAGG + Intronic
1028486602 7:91365370-91365392 CTATATGGTCTGAGGAGGGGAGG + Intergenic
1029119243 7:98255456-98255478 CTATATGGTCTGAAAAGGAGGGG + Intronic
1029499067 7:100916482-100916504 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1029499496 7:100919460-100919482 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1029588538 7:101491615-101491637 CTATATGGTCTAAAAAGGGGAGG - Intronic
1030174705 7:106640145-106640167 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1030224107 7:107129775-107129797 CTATATGATCTAAAAAGGGGAGG - Intronic
1030396488 7:108993033-108993055 CAGTATGGTCTGAAATGTGGTGG + Intergenic
1030601309 7:111596390-111596412 CTGTATGGTCTAAAAAAGGGAGG - Intergenic
1030800580 7:113845282-113845304 CTGTAAGGTCTGTGAATGTGCGG + Intergenic
1031173470 7:118320115-118320137 CTATATGATCTAAAAAGGGGAGG - Intergenic
1031289855 7:119920150-119920172 CTGTGTGGCCTGAAATGGTTTGG + Intergenic
1031533699 7:122908230-122908252 CTATATGATCTAAAAAGGGGAGG - Intergenic
1031582993 7:123500055-123500077 CTATATGGTCTAAAAAGGGGAGG + Intronic
1031703978 7:124959513-124959535 CAATATGGTCTGAAAGGGGGAGG - Intergenic
1031704718 7:124965471-124965493 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1031775884 7:125908899-125908921 ATATATGGTCTAAAAAGGGGAGG + Intergenic
1032088945 7:128901187-128901209 CTATATGGTCTAAAAAGGGGAGG + Intronic
1032123047 7:129170509-129170531 TTACATGGTCTAAAAAGGTGAGG - Intergenic
1032340929 7:131072200-131072222 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1032461616 7:132115546-132115568 CTATATGGTCTGAAAGGGGGAGG + Intergenic
1032671491 7:134086867-134086889 CTATATGGTCTAAAAAGGCGAGG - Intergenic
1032671882 7:134091308-134091330 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1032864218 7:135909727-135909749 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1032961538 7:137041120-137041142 ATATATGGTCTAAAAAGGGGAGG + Intergenic
1033161549 7:139001489-139001511 ATATATGGTCTAAAAAGGGGAGG + Intergenic
1033162137 7:139006963-139006985 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1033162484 7:139009945-139009967 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1033465850 7:141588791-141588813 CTGTATGGTCTAAAAAGGGGAGG - Intronic
1033718896 7:144035814-144035836 CTATTTGGTCTAAAAAGGGGAGG + Intergenic
1033864932 7:145677972-145677994 CTGCACGGTCTAAAAAGGGGAGG + Intergenic
1034335724 7:150322540-150322562 CTATATGGTCTAAAAAGGGGAGG + Intronic
1034434347 7:151056059-151056081 CTGTATGGTCCAGGAAGGTGGGG - Intronic
1035872707 8:3153250-3153272 CTCTATGGTCTAAAAAGGGGAGG + Intronic
1035924857 8:3716443-3716465 CTATATGGTCTAAAAAAGGGAGG - Intronic
1036197559 8:6733608-6733630 CTGTTTAGTCTGAAACAGTGTGG + Intronic
1036460151 8:8945395-8945417 CTATATGGTCTATAAAGGGGAGG + Intergenic
1036514870 8:9434436-9434458 CTTTATGGACTGGAAAGGGGAGG - Intergenic
1036576242 8:10030029-10030051 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1036746475 8:11413486-11413508 CTATATGGCCTGAAAGGGGGAGG + Intronic
1037163688 8:15801209-15801231 GTATATGGTCTAAAAAGGAGAGG - Intergenic
1037304326 8:17489459-17489481 CTATATCGTCTAAAAAGGGGAGG - Intergenic
1037314156 8:17585029-17585051 CTATATGGTCTAAAAAGGAGAGG - Intronic
1037367980 8:18143236-18143258 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1037380026 8:18275109-18275131 CTATTTGGTCTAAAAAGGGGGGG + Intergenic
1037466700 8:19168030-19168052 CCATACGGTCTGAAAAGGGGAGG + Intergenic
1037614642 8:20507767-20507789 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1038126541 8:24679703-24679725 CTATATGGTCTAAAAAAGGGAGG + Intergenic
1038338883 8:26667566-26667588 CTCTATGGTCTAAAAGGGGGAGG + Intergenic
1038439600 8:27562107-27562129 CTATATGGTGTAAAAAGGGGAGG - Intergenic
1038645707 8:29360094-29360116 CTTTATGATCTAAAAAGGGGAGG + Intergenic
1039049894 8:33483761-33483783 CTATATGGTCTAAAAAGGAGAGG - Intronic
1039569692 8:38576849-38576871 GTATATGGTCTAAAAAGGGGAGG + Intergenic
1039576017 8:38624653-38624675 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1039579588 8:38653225-38653247 CTATATGGCCTAAAAAGGTGAGG + Intergenic
1039604146 8:38866981-38867003 CAATATGGTCTAAAAAGGGGAGG + Intergenic
1039827466 8:41187177-41187199 CTATATGGTCTAAAAGGGTGAGG - Intergenic
1040613312 8:49008744-49008766 CTGTATGGTCTAAAAAGGGAAGG - Intergenic
1040854668 8:51936449-51936471 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1041068716 8:54105564-54105586 CTATATGGTCTAAAGAGGGGAGG + Intergenic
1041073867 8:54151364-54151386 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1041652379 8:60313619-60313641 CTATATGATCTAAAAAGGAGAGG - Intergenic
1041716300 8:60935435-60935457 CTATATGGTCTAAAAAGGGTAGG + Intergenic
1041773476 8:61497848-61497870 CTATATGGTCTAAAAAGCGGAGG - Intronic
1041952636 8:63521179-63521201 CAGTAAGATTTGAAAAGGTGAGG + Intergenic
1042159105 8:65874128-65874150 CTCTATGGTCTAAAAAGGGAAGG + Intergenic
1042358245 8:67853326-67853348 CTATATGGTCTAAAAAGGAGAGG - Intergenic
1042727223 8:71890982-71891004 CTACATGGTCTAAAAAGGGGAGG + Intronic
1042987677 8:74602341-74602363 CTATATGGTCTAAAAAGGGAAGG + Intronic
1043004099 8:74796697-74796719 CTGTATGGTCTAAAAAGGGGAGG - Intronic
1043068461 8:75607298-75607320 CAGTATGGAGTGAAAAGCTGTGG - Intergenic
1043070626 8:75631443-75631465 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1043081126 8:75766398-75766420 CTATATGCTCTAAAAAGGGGAGG - Intergenic
1043981156 8:86641203-86641225 CTATATAGTCTAAAAAGGGGAGG + Intronic
1044439231 8:92203970-92203992 TTATATGGTCTAAAAAGGGGAGG - Intergenic
1044562471 8:93626793-93626815 CTGTAGGGTCTTTCAAGGTGAGG - Intergenic
1044657320 8:94562082-94562104 CTATATGGTGTAAAAAGGGGAGG - Intergenic
1044991743 8:97802353-97802375 CTATATGGCCTGAAATGGGGAGG - Intronic
1045056664 8:98374246-98374268 CTGTCTGGTCTGAACAACTGAGG + Intergenic
1045253169 8:100498063-100498085 CTATATGGTCTAAAAATGGGAGG - Intergenic
1045457154 8:102392021-102392043 CTATATGGTCTAAAAAGGGGAGG + Intronic
1045643933 8:104281892-104281914 TTGTATGGCCTGAAATGGGGAGG - Intergenic
1045688537 8:104736706-104736728 CTATATGGTCTAAAAAGGGGAGG + Intronic
1045691238 8:104762132-104762154 CTATATGGTCTAAAAAGGGGAGG - Intronic
1046511569 8:115210788-115210810 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1046613807 8:116454179-116454201 CTGTAGAGTCTGAAATGGGGTGG - Intergenic
1046743396 8:117851881-117851903 CAGTATAGTCTGAAAAGGGTTGG + Intronic
1046837645 8:118820859-118820881 CTATATGGTCTAAAAAGCAGAGG - Intergenic
1046920102 8:119718797-119718819 CTATATTGTCTAAAAAGGGGAGG + Intergenic
1047003416 8:120595447-120595469 CTATATGGTCTAAAAGGGGGAGG + Intronic
1047210612 8:122837106-122837128 CTATATGGTCTAAAAAGGGGAGG + Intronic
1047390873 8:124450250-124450272 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1047421227 8:124709941-124709963 CTGTATGATGTGATAAGTTGGGG - Intronic
1047526711 8:125640241-125640263 CTATATGGTCTAAAAAGGGCAGG + Intergenic
1049124517 8:140774875-140774897 CTGTATGGTCTAAAAAGGGGAGG + Intronic
1049609485 8:143547412-143547434 CTATGTGGTCTGAAAGGGGGAGG - Intergenic
1049710647 8:144061658-144061680 CTATATGGTCTAGAAAGGGGAGG + Intronic
1049954123 9:675926-675948 CTATATGGTCTAAAAAGGGGAGG - Intronic
1050104013 9:2146735-2146757 CTATGTGGTCTAAAAAGGGGAGG - Intronic
1050549097 9:6733830-6733852 CTATATGGTCTAAAAAGGGGAGG - Intronic
1050735044 9:8752381-8752403 CTACATGGTCTAAAAAGGGGAGG + Intronic
1050741491 9:8825780-8825802 CTATATGGTCTAGAAAGGGGAGG - Intronic
1050756860 9:9015453-9015475 CTACATTGTCTGAAAAGGGGAGG + Intronic
1050959213 9:11705952-11705974 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1051243431 9:15084229-15084251 CTGTATGGTCTACAAAGGGAAGG - Intergenic
1051428238 9:16956201-16956223 CCTTATGGGCTGAAAAGGAGTGG + Intergenic
1051467410 9:17396113-17396135 CTATGTGGTCTAAAAAGGGGAGG + Intronic
1051467543 9:17397410-17397432 CTATATGGTCTAAAAAGGGGAGG - Intronic
1051583822 9:18706180-18706202 CTATATGGTCTGAAAAGGGGAGG - Intronic
1051720649 9:20033721-20033743 CTATGTGGTCTAAAAAGGGGAGG + Intergenic
1051772587 9:20594842-20594864 CTGTATGGTCCAAAAAGGAGAGG + Intronic
1051859628 9:21609614-21609636 CTATATGGTCTAAAAAGGGAAGG + Intergenic
1052381027 9:27771030-27771052 CTATATGCTCTGAAAAGGGGAGG + Intergenic
1052427515 9:28324691-28324713 CTATATGGTCTAAAAAGGGGAGG + Intronic
1052520873 9:29547399-29547421 CTATATGGTCCAAAAAGGGGAGG + Intergenic
1052759873 9:32579171-32579193 CTATATGGTCTACAAAGGGGAGG + Intergenic
1052773451 9:32710353-32710375 CTCTATGGTCTAAAATGGGGAGG + Intergenic
1052815620 9:33100686-33100708 CTATACGGTCTAAAAAGGGGAGG - Intergenic
1052817792 9:33114914-33114936 CTGAATGGTCAGAACAGCTGGGG - Intronic
1053060427 9:35026510-35026532 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1053249063 9:36559408-36559430 CAATATGGTCTAAAAAGGGGAGG - Intergenic
1053458871 9:38253033-38253055 CTATATGGTCTAAGAAGGGGAGG + Intergenic
1054796509 9:69307205-69307227 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1055290767 9:74779803-74779825 CTGTATGGTCTGAAAAACTGAGG + Intronic
1055331445 9:75188062-75188084 CTGTGTGGTCCAAAAAGGGGAGG - Intergenic
1055451783 9:76437469-76437491 TTATATGGTCTAAAAAGGGGAGG + Intronic
1055567610 9:77584833-77584855 CTATATGGTCTGAAAAGGGGAGG - Intronic
1055598757 9:77893400-77893422 TTATATGGTCTGAAAAGGGGAGG + Intronic
1055701101 9:78946816-78946838 CTATATGGTCTGAAAAGGGGAGG - Intergenic
1056299870 9:85229865-85229887 CTGTATGGACTGAGAAGTGGAGG - Intergenic
1056393900 9:86164134-86164156 CTATATGGTCTAAAATGGAGAGG - Intergenic
1056469885 9:86895001-86895023 CTATATGGTCTAAAAATGGGAGG + Intergenic
1056528688 9:87467950-87467972 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1056656594 9:88514613-88514635 CTATATGGCCTAAAAAGGGGAGG + Intergenic
1056681344 9:88721717-88721739 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1056727924 9:89138385-89138407 CTATATGGTCTTAAAAGGGGAGG - Intronic
1056746559 9:89309092-89309114 CTACATGGTCTAAAAAGGGGAGG - Intergenic
1056892304 9:90506485-90506507 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1056914903 9:90737979-90738001 CTATGTGGTCTGAAATGGGGAGG - Intergenic
1057333367 9:94137412-94137434 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1057358546 9:94352213-94352235 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1057557838 9:96101748-96101770 CTGTACGGTCTATAAAGGGGAGG + Intergenic
1057649205 9:96905397-96905419 CTATATGGTCTAAAAAAGGGAGG + Intronic
1057943134 9:99302251-99302273 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1057988956 9:99747490-99747512 CTATATGATCTAAAAAGGGGAGG + Intergenic
1058037283 9:100266439-100266461 CTATAAGGTCTGAAAAGGGGAGG - Intronic
1058118954 9:101117453-101117475 CTATATGATCTAAAAAGGGGAGG + Intronic
1058291329 9:103244174-103244196 CAATATGGTCTAAAAAGGGGAGG - Intergenic
1058355319 9:104077494-104077516 CTATATGGTCTTAAAAGGGGAGG - Intergenic
1058356070 9:104084590-104084612 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1058376423 9:104327368-104327390 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1058455522 9:105134609-105134631 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1058465525 9:105223343-105223365 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1058602265 9:106682946-106682968 CTAGATGGTCTAAAAAGGGGAGG + Intergenic
1058710595 9:107675657-107675679 CTCTGTGGTCTAAAAAGGGGAGG - Intergenic
1058756246 9:108085435-108085457 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1059477227 9:114557261-114557283 CTGTATGACCTAAAAAGGGGAGG - Intergenic
1059546633 9:115182521-115182543 CTATAAGGTCTGAAAAGGGAAGG + Intronic
1059838418 9:118183919-118183941 CTATATGGTCTAAGAAGGTGAGG + Intergenic
1059912005 9:119054958-119054980 CTATATGGTCTAAAAAGGTGGGG - Intergenic
1060499373 9:124141393-124141415 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1060681290 9:125567484-125567506 CTATATGGTCTAAAAAGGGGAGG + Intronic
1060681887 9:125573417-125573439 CTATATGGTCTAAAAAGGGGAGG + Intronic
1061635621 9:131906921-131906943 CTATATAGTCTAAAAAGGAGTGG - Intronic
1061824313 9:133248256-133248278 CCATATGGTCTAAAAAGGAGAGG - Intergenic
1062130527 9:134890308-134890330 ATGTATGGTCTAAAAAAGGGAGG + Intergenic
1062222012 9:135421516-135421538 CTATATGGTCTGATAAGGGCAGG + Intergenic
1062548607 9:137075404-137075426 CTATATGGTCTACAAAGGGGAGG + Intergenic
1185561075 X:1061057-1061079 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1185651912 X:1654252-1654274 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1185663188 X:1743269-1743291 CTGTATGGTCTAAAAGGGGGAGG - Intergenic
1185702630 X:2242729-2242751 CTCTACGGTCTAAAAAGGGGAGG + Intronic
1185712931 X:2318630-2318652 CTATAGGGTCTAAAAAGGGGAGG + Intronic
1185750208 X:2604826-2604848 CTACATGGTCTAAAAAGGGGAGG + Intergenic
1185769566 X:2755328-2755350 CTGCATGGTCTAAAAAGGGGAGG - Intronic
1185770806 X:2764196-2764218 CTATATGGTCTAAAAAGAGGAGG + Intronic
1185817269 X:3167983-3168005 CTATATGGTCCCAAAAGGGGAGG - Intergenic
1185841819 X:3398984-3399006 CTACATGGTCTAAAAAGGGGAGG + Intergenic
1185859752 X:3566560-3566582 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1185868172 X:3640971-3640993 CTGTATGCTCTAAAAAGGGGAGG + Intronic
1185875865 X:3701880-3701902 CTATTTGGTCTAAAAAGGGGAGG + Intronic
1185880019 X:3732524-3732546 TTATATGGTCTAAAAAGGGGAGG - Intergenic
1185884631 X:3771571-3771593 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1185959863 X:4537679-4537701 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1185971996 X:4675555-4675577 CTCTATGGTCTATAAAGGGGAGG - Intergenic
1185983259 X:4803155-4803177 CTATATGGTCTACAAAGGGGAGG + Intergenic
1186056075 X:5650956-5650978 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1186089086 X:6024756-6024778 CTATATGGTCTAAAAAGGGGAGG + Intronic
1186165679 X:6823808-6823830 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1186182422 X:6986091-6986113 CTATACGGTCTAAAAAGGGGAGG + Intergenic
1186185748 X:7018066-7018088 CTATATGGTCTAGAAAGGGGAGG + Intergenic
1186187070 X:7031002-7031024 CTATATGGACTAAAAAGGGGAGG - Intergenic
1186339440 X:8628232-8628254 CTATATGGTCTAAAAGGGGGAGG + Intronic
1186833452 X:13414197-13414219 CTATATGATCTTAAAAGGGGAGG - Intergenic
1186883550 X:13890291-13890313 CTATATGGTCTAGAAAGGGGAGG + Intronic
1187070529 X:15883112-15883134 CTCTATGGTCTAAAAAGGGGAGG - Intergenic
1187140254 X:16586414-16586436 CTATATAGTCTAAAAAGGGGAGG + Intergenic
1187376771 X:18762652-18762674 CTATGTGGTCTAAAAAGGGGAGG - Intronic
1189086146 X:38026633-38026655 CTGTATGATCTAAAAAGGGGAGG - Intronic
1189351796 X:40281013-40281035 CTATATGGTCTAAAAAGAGGAGG + Intergenic
1189390392 X:40571402-40571424 CTATATGGTCTAAAAGGGGGAGG - Intergenic
1189743143 X:44142365-44142387 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1189834861 X:45009287-45009309 CTGTAAGGTCTAAAAAGGTGAGG - Intronic
1189953832 X:46258581-46258603 CTTTATGGTCTAAAAATGGGAGG + Intergenic
1189965508 X:46368507-46368529 CTATATGGTCTGAAAAGGGAAGG - Intergenic
1190137416 X:47809254-47809276 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1190465433 X:50721412-50721434 CTGTATGGTCTAAAAAGGGGAGG - Intronic
1190815103 X:53922935-53922957 GTATATGGTCTAAAAAGGGGAGG + Intergenic
1190920283 X:54845040-54845062 CTATATGGTCTAAAAAGGAGAGG - Intergenic
1190963581 X:55276732-55276754 CTATATGGTCTAAAAAGGGGAGG + Intronic
1191612903 X:63136001-63136023 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1191623394 X:63242925-63242947 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1191636854 X:63387851-63387873 CTATATGGTCTAAAAGGGGGAGG + Intergenic
1191710966 X:64149689-64149711 CAGTATGGTAGGAAAATGTGGGG - Intergenic
1192121745 X:68462985-68463007 CTATATGGTTTTAAAAGGGGAGG + Intergenic
1192542208 X:71983742-71983764 CTATAAGGTCTAAAAAGGGGAGG - Intergenic
1192864522 X:75116970-75116992 CTATATGGTCTAAAAAGGGGAGG + Intronic
1192865085 X:75122338-75122360 CTATGTGGTCTAAAAAGGGGAGG + Intronic
1193697886 X:84730960-84730982 CTTTATGGTCTAAAACGGGGAGG - Intergenic
1194040981 X:88941639-88941661 CTGTATGGTTTAGAAAGGGGAGG - Intergenic
1194085856 X:89527996-89528018 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1194997825 X:100611040-100611062 CTATATGGTCTAATAAGGGGAGG - Intergenic
1195922870 X:110000999-110001021 CTATATGGTCTGAAAGGGGGAGG - Intergenic
1196132156 X:112168686-112168708 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1196401743 X:115324045-115324067 CTATATGGTCTTAAAAGGGGAGG - Intergenic
1197464502 X:126785953-126785975 ATATATGGTCTAAAAAGGGGTGG - Intergenic
1197653478 X:129090324-129090346 CTGGATGCCCTGAACAGGTGAGG - Intergenic
1197904577 X:131411289-131411311 CTATATGGGCTAAAAAGGGGAGG + Intergenic
1197924466 X:131632276-131632298 CTGTAAGGTCTGAAGTGGTGAGG + Intergenic
1198454779 X:136805745-136805767 CTCTATGGTCTAAAAACGGGAGG + Intergenic
1198844417 X:140895250-140895272 CTATATGGTCTAAAAAAGGGAGG - Intergenic
1198844965 X:140900590-140900612 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1198846984 X:140922978-140923000 CTATATGGTCTAAAAAAGGGAGG - Intergenic
1199313702 X:146351314-146351336 CTATATAGTCTTAAAAGGGGAGG + Intergenic
1199394884 X:147323923-147323945 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1199404579 X:147442218-147442240 CTATATGGTCTAAAAAGGGGAGG + Intergenic
1199404914 X:147445395-147445417 CTGTACGGTCTAAAAGGGGGAGG + Intergenic
1199994279 X:153010347-153010369 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1200148658 X:153940774-153940796 CTATATGGTCTAAAAAGGGGAGG + Intronic
1200438506 Y:3183863-3183885 CTATATGGTCTAAAAAGGGGAGG - Intergenic
1200584309 Y:4988759-4988781 CTATATAGTCTAAAAAGGGGAGG - Intergenic
1200785846 Y:7259684-7259706 TTATATGGTCTAAAAAGGGGAGG + Intergenic
1200789715 Y:7288544-7288566 CTATTTGGTCTAAAAAGGGGAGG - Intergenic
1200796065 Y:7342374-7342396 CTGTATGCTCTAAAAAGGGGAGG - Intergenic
1200805972 Y:7434298-7434320 CTCTATGGTCTAAAAAGGGGAGG + Intergenic
1201115251 Y:10830515-10830537 CTGTATGGAATGGAAAGGAGTGG - Intergenic
1201264020 Y:12188469-12188491 CTATATGGTCCCAAAAGGGGAGG + Intergenic
1201299488 Y:12493585-12493607 CTATATGGTCTAAAAAGAGGAGG - Intergenic
1201300945 Y:12504301-12504323 CTGCATGGTCTAAAAAGGGGAGG + Intergenic
1201702214 Y:16896486-16896508 TTATATGGTCTAAAAAGGAGAGG - Intergenic
1201748868 Y:17410770-17410792 CTGTATGGTCTAAAAAGAGGAGG + Intergenic
1201920992 Y:19233192-19233214 CTGCATGGTCAGCAAAGGTCTGG - Intergenic
1202302124 Y:23427911-23427933 CTATATGGTCTAAAATGGGGAGG - Intergenic
1202568687 Y:26242687-26242709 CTATATGGTCTAAAATGGGGAGG + Intergenic