ID: 1145772047

View in Genome Browser
Species Human (GRCh38)
Location 17:27500259-27500281
Sequence CTCTGGACCCTAATGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145772047 Original CRISPR CTCTGGACCCTAATGCTCAA GGG (reversed) Intronic
900873891 1:5327441-5327463 CTCTGGACACTGATGCTCAGGGG - Intergenic
904091086 1:27945562-27945584 CTGAGGAACCTAAAGCTCAAAGG + Intronic
904280109 1:29413111-29413133 CTCTGGGCCCTATTCCTCAAAGG + Intergenic
907813920 1:57899863-57899885 CTCAGGAAACTCATGCTCAATGG + Intronic
908829509 1:68165211-68165233 CTCTGAACCCTATGGCTCCAAGG - Intronic
910655927 1:89617997-89618019 CTGTGGACTCTAAGGCTCAGGGG - Intergenic
914934276 1:151964579-151964601 AGCTGGACACTAATGCTCATTGG + Intergenic
919978401 1:202627606-202627628 CTCTGGAGAGTAATGCGCAAAGG + Intronic
920017974 1:202928595-202928617 CTGTGGATCCTAAGGCTCAGAGG - Intronic
1067384456 10:45805842-45805864 CACCGGAACCTAAGGCTCAATGG - Intergenic
1071432856 10:85619812-85619834 CTCAGGACTCTAGTGGTCAAGGG - Intronic
1076278483 10:129225315-129225337 CTCTGGCCCCTAAAGCAAAAAGG - Intergenic
1080403435 11:31957766-31957788 CTAAGGAGCCGAATGCTCAAGGG - Intronic
1081680411 11:44998675-44998697 CTCTGTACCCTAAGGCTCAGAGG + Intergenic
1085644967 11:78216961-78216983 GGCTGGACCCATATGCTCAAAGG + Exonic
1088836074 11:113578726-113578748 CTCAGGTCCCTAAAGCTCAAAGG + Intergenic
1088854524 11:113735330-113735352 CTCTGGAGCCTATTACTTAAAGG + Intronic
1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG + Intergenic
1093520811 12:20047794-20047816 CTCTGGACACTAGGGCTCACTGG - Intergenic
1099684800 12:85871309-85871331 CTCTGGAACCAACTGATCAAGGG - Intergenic
1100210670 12:92395351-92395373 CCCTGGAACCTAATGTTTAAAGG - Intergenic
1104990078 12:132619838-132619860 TTGTGGACCCTTATGCTCTAGGG - Exonic
1107342709 13:39425902-39425924 CTCTGAACACTAAGGCTGAAGGG - Intronic
1110938035 13:81317517-81317539 CTATGGGCCCTAGGGCTCAAAGG + Intergenic
1118318591 14:64740508-64740530 CTCTAGACCCTAATCCACATGGG + Intronic
1122233652 14:100320091-100320113 TGCTGGGCCCTAATGATCAAAGG - Intergenic
1124646784 15:31442571-31442593 TTCTGCACCCTAATGCTGGAGGG + Intergenic
1125010962 15:34874691-34874713 CTGTTGACCTTGATGCTCAAGGG - Exonic
1128283215 15:66414584-66414606 CTCTGGACACTGAAGCTCAGGGG - Intronic
1129230942 15:74196957-74196979 ACCTGGACCCTAATGCTTGAAGG - Intronic
1129670338 15:77604411-77604433 CCCTCGACCCTCATTCTCAAAGG - Intergenic
1129740075 15:77985847-77985869 CTCTGGAGCCTCCTCCTCAATGG - Intronic
1129845681 15:78766758-78766780 CTCTGGAGCCTCCTCCTCAATGG + Exonic
1130598776 15:85262884-85262906 CTCTGGAGCCTCCTCCTCAATGG + Intergenic
1139326597 16:66157223-66157245 CTCAGGACTCTAAGGCTCCAAGG + Intergenic
1140523247 16:75600340-75600362 TTCTGCACCCTAATGCACACAGG + Exonic
1142096403 16:88242202-88242224 CACTGGGCCCTAAGGTTCAAGGG + Intergenic
1144412870 17:15018535-15018557 CTCTGGCTCCTAACTCTCAAAGG - Intergenic
1145772047 17:27500259-27500281 CTCTGGACCCTAATGCTCAAGGG - Intronic
1146986045 17:37219200-37219222 CTCTGGACACTGAAGGTCAATGG + Intronic
1155153954 18:23143190-23143212 CTCTGGGCCCAAATGCACAGAGG - Intronic
1156883627 18:42109208-42109230 CTCTGTATCCAAATCCTCAAAGG + Intergenic
1158119357 18:54031033-54031055 ATCTGTACCCAAATGCACAAAGG - Intergenic
1158549667 18:58424685-58424707 GTCTGAACCCAAATGCCCAAAGG + Intergenic
1160089418 18:75812439-75812461 CTCTGGAACCCAATGATGAAAGG - Intergenic
1161035306 19:2081228-2081250 ATCTGGACCCAAATGTTCACAGG + Intronic
1167751240 19:51381481-51381503 CTCTGGACACTGAAGCTCAGTGG + Intronic
1168406116 19:56111534-56111556 TTGTGGACCCTTATGCTAAAAGG - Intronic
926078328 2:9961363-9961385 CTCAAGCCCCAAATGCTCAAAGG + Exonic
935087793 2:99865341-99865363 CTCTAGAGCCTATTGCTCATGGG - Intronic
935238165 2:101155181-101155203 CTCTGGTCCCAGCTGCTCAAAGG + Intronic
935666660 2:105518403-105518425 CTCTGGACCATAGTCCTCACAGG + Intergenic
939214194 2:139214855-139214877 CTTTGGAGCCTGATGCTCAAGGG - Intergenic
944278986 2:197872487-197872509 CACTGTACCCTAATGGTTAAGGG + Intronic
944481434 2:200161428-200161450 CTCTGGACACTGAAGCTCAGCGG - Intergenic
947801759 2:232933182-232933204 CTCTAGACCCAACTTCTCAAAGG + Intronic
1175404673 20:58718364-58718386 CTCTGGCCCCTGCTGCCCAAGGG + Intronic
1175697167 20:61111255-61111277 CTTTTGACCCCAAAGCTCAAGGG - Intergenic
1178440338 21:32593308-32593330 CCCTGGACCCTAAGGCTCGGGGG + Intronic
1178484074 21:33005981-33006003 CACTGGACCCAAATGCACAGAGG - Intergenic
1178721282 21:35011885-35011907 ATCTGGACCCTAAAGCTTAACGG + Intronic
1179730473 21:43364662-43364684 CTCTGGTCCCTGATGCTCAGAGG + Intergenic
1183663070 22:39232906-39232928 CTCTGGGACCTAATGATCTACGG + Intronic
949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG + Intergenic
950140693 3:10613125-10613147 CTCTGGACACCAAAGCTCAGTGG + Intronic
956143595 3:66170409-66170431 CACAGGACACTAATGCTCACTGG + Intronic
961511976 3:127408817-127408839 CTCTGCACCCTGATGCCCATAGG - Intergenic
964915177 3:161832206-161832228 CTCTGGACACTGAAGCTCAGTGG - Intergenic
965346762 3:167560467-167560489 CTCTAGACACTAAAGCTGAATGG - Intronic
965408825 3:168304167-168304189 CTCTGGACACTGAGGCTCAGCGG - Intergenic
966935535 3:184706308-184706330 CTCTGAACGCTAATTCACAATGG + Intergenic
968419963 4:475514-475536 CTATGCAACCTAATGCTCTATGG + Intronic
972289354 4:37677185-37677207 CCCTTGATCCTCATGCTCAAGGG - Intronic
972573782 4:40333557-40333579 CACTGGACCCCAATGGGCAAAGG + Intergenic
974377477 4:61096847-61096869 TTCTGGTCCATAATCCTCAAAGG + Intergenic
976145256 4:82036410-82036432 CTCTGGGCCCTACTGCTCCTAGG + Intronic
977051758 4:92137065-92137087 CTCTGATCTCTAATGCTCAATGG + Intergenic
978248739 4:106605239-106605261 TTCTGTACCCTAATGCTCTTGGG - Intergenic
983110195 4:163740497-163740519 CCCTGTACCCTATTGCTCAGTGG - Intronic
986609219 5:9550040-9550062 CTCTGGAACCCATTTCTCAAGGG + Intergenic
986945321 5:13011219-13011241 CTCTGGACCCTAAAGGCAAATGG - Intergenic
988486532 5:31672377-31672399 GGCTGGACCCAAAGGCTCAAAGG + Intronic
990567210 5:57041764-57041786 CCCTGGACTCTGATGCTCAGAGG - Intergenic
992805294 5:80331434-80331456 CTCTCGACTCTAATACTCAAGGG + Intergenic
994560600 5:101366206-101366228 TTCTGGACCCCAATACTCAGGGG + Intergenic
997205308 5:132044781-132044803 TTCTGGATACTAATGCTCTATGG - Intergenic
1000262608 5:159602399-159602421 CTCTGGAAACCAAGGCTCAAAGG - Intergenic
1006975278 6:38094932-38094954 CTCTGGAACATGGTGCTCAAAGG - Intronic
1008004174 6:46392518-46392540 CTCTGGAACCTAACACTTAATGG + Intronic
1008839751 6:55888072-55888094 CTGTGGACTCTAGTGCTTAAAGG - Intergenic
1016539328 6:145145846-145145868 CTCTGTACCCTGATTCTCAGGGG - Intergenic
1017999889 6:159569746-159569768 CTCTGGACACTGAAGCTCAGTGG - Intergenic
1021360051 7:19701614-19701636 CTCTGTAACTTAATGCTCTAAGG - Intronic
1024858203 7:53806258-53806280 CCCTGGACACTAATGCTCAGTGG - Intergenic
1029318574 7:99736748-99736770 CTCTGGCCCCTAAGCCTCCAGGG + Intergenic
1029323503 7:99785734-99785756 CTCTGGCCCCTAAGCCTCCAGGG + Intergenic
1032130263 7:129222174-129222196 TTCTTCCCCCTAATGCTCAAGGG - Intergenic
1042816787 8:72886904-72886926 CGCTGGGCCCTAATTTTCAAGGG + Intronic
1047337836 8:123953455-123953477 CTCTGGACCCTGCTGCCCATTGG - Intronic
1049761284 8:144332995-144333017 CTCGGGACCCTATTGCTTGAAGG + Exonic
1050737316 9:8779023-8779045 CTCTGAAACGTAAAGCTCAAAGG + Intronic
1057207414 9:93182017-93182039 CTGTGTACCCTAATGGTCATGGG + Intergenic
1057855187 9:98596082-98596104 CTCTGTAGCTTAATGGTCAAGGG + Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1191998911 X:67127109-67127131 CTCAGGACCCTGATGCTCTGTGG + Intergenic
1196744243 X:119055232-119055254 TTATGGACAATAATGCTCAAAGG - Intergenic
1199760747 X:150902373-150902395 CTCTGGTCCCTAAGGATCAATGG - Intergenic
1200231881 X:154448006-154448028 CTCTTTAGCCTGATGCTCAAGGG - Intronic
1201909587 Y:19120614-19120636 CTCTGGACCCTGCAGCTGAATGG + Intergenic