ID: 1145772408

View in Genome Browser
Species Human (GRCh38)
Location 17:27502945-27502967
Sequence TGGCATTGCCTGTCAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145772408_1145772414 14 Left 1145772408 17:27502945-27502967 CCAGTTACTGACAGGCAATGCCA 0: 1
1: 0
2: 2
3: 16
4: 111
Right 1145772414 17:27502982-27503004 TTACCATTTACCATGTGCCTGGG 0: 1
1: 0
2: 2
3: 21
4: 197
1145772408_1145772417 30 Left 1145772408 17:27502945-27502967 CCAGTTACTGACAGGCAATGCCA 0: 1
1: 0
2: 2
3: 16
4: 111
Right 1145772417 17:27502998-27503020 GCCTGGGCTGAGTGCTCTAAAGG 0: 1
1: 0
2: 0
3: 21
4: 162
1145772408_1145772413 13 Left 1145772408 17:27502945-27502967 CCAGTTACTGACAGGCAATGCCA 0: 1
1: 0
2: 2
3: 16
4: 111
Right 1145772413 17:27502981-27503003 CTTACCATTTACCATGTGCCTGG 0: 1
1: 0
2: 13
3: 133
4: 882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145772408 Original CRISPR TGGCATTGCCTGTCAGTAAC TGG (reversed) Intronic
904914875 1:33962568-33962590 TGGCATTTCCTCTGAGTAAGAGG - Intronic
906825800 1:48978495-48978517 GGGCATTGCCTGTCTGTGGCTGG - Intronic
907126689 1:52056518-52056540 TGGCTTGGCCTGTCGGTTACCGG + Intronic
910341273 1:86190839-86190861 TGGCATTCCTTGTTAGTAGCTGG + Intergenic
912378139 1:109229658-109229680 TGGCATTGTCTGTCAGAAGCAGG + Intronic
912932493 1:113977185-113977207 TGAAATTGCCTCTCAGTGACAGG + Exonic
917393861 1:174570131-174570153 TAGGATTGCCTGTCAGCAACTGG - Intronic
919810258 1:201404939-201404961 TGGCTTTGCCTGGCAGTCAGGGG - Exonic
923628911 1:235636716-235636738 TGCCATCGCCTGTCAGTATTGGG - Intronic
1063958476 10:11286288-11286310 TGGCTCTGCCTGTCATTAATCGG + Intronic
1065797144 10:29318398-29318420 TTGCACTGCCTGTCAGTTCCTGG - Intergenic
1065946011 10:30605935-30605957 TTGCACTGCCTGTCAGTTCCTGG + Intergenic
1067237411 10:44462703-44462725 TGGCAGTCCCTGTCAGTCCCTGG - Intergenic
1069873233 10:71545903-71545925 TGGCATTGCCCGTCACTCCCTGG - Intronic
1072926637 10:99621574-99621596 TGGCCTTGCCTCTCAGGACCCGG - Intergenic
1073593962 10:104782187-104782209 TGACAGTGCCTGTCAGTCACTGG - Intronic
1076815156 10:132910998-132911020 TGGCATTTCCTCTCAGCATCTGG + Intronic
1077701339 11:4444841-4444863 TGGCATGGCCTGTTAGGAACTGG + Intergenic
1081305168 11:41502846-41502868 TGGCATTACCTGTCATTACCTGG + Intergenic
1087961945 11:104362742-104362764 TGGCATAGCATGGAAGTAACTGG - Intergenic
1088972802 11:114788315-114788337 TGGCCCTGCTTGTCAGTGACTGG - Intergenic
1089262045 11:117230133-117230155 TCGCAGTGCCTGTGAGCAACTGG - Intronic
1089499612 11:118924763-118924785 AGGCACTGCCTGTGAGTAGCGGG - Intronic
1090274268 11:125408684-125408706 TGGCAGAGCCTGTCAGGAAGTGG - Intronic
1097231102 12:57511729-57511751 GGACATTGCCTGGCAGTGACTGG + Exonic
1102467183 12:113136660-113136682 TGACATTGCATTTCAGTCACAGG + Intergenic
1102689179 12:114747130-114747152 TGGCCTGGCCCGTCAGTCACAGG - Intergenic
1104559320 12:129829635-129829657 TGGCATTTCCTGGCAGAAGCAGG - Intronic
1108825005 13:54402746-54402768 TGACATTTCCTGTAAGTGACGGG + Intergenic
1110466630 13:75809253-75809275 TGGCATGGCATGTCACTAAATGG + Intronic
1110760534 13:79225623-79225645 TAGCATTGCCGGTGAGTGACAGG + Intergenic
1111110324 13:83699972-83699994 TGGTATTGACTGTCAGAAACAGG - Intergenic
1112068322 13:95818636-95818658 AGGCACTTCCTCTCAGTAACAGG - Intronic
1114233058 14:20801301-20801323 TGGCATTGCCTTCCAGCAAGGGG - Exonic
1114562821 14:23605414-23605436 TGCCATTACCTGTCAGGAAAGGG + Intergenic
1120196743 14:81492825-81492847 TCGCTTTGCCTGTAAGTAACAGG - Intronic
1123552557 15:21397380-21397402 TGGCCTTGCCTGTCATGCACAGG + Intergenic
1139733432 16:68967426-68967448 GGGCATGGCCTGTTAGGAACGGG - Intronic
1140414950 16:74767917-74767939 TTGCATGGCCTGGCAGCAACTGG - Intronic
1144686050 17:17227061-17227083 TGGAATTGCCTGTAAGGAATGGG - Intronic
1145289588 17:21532841-21532863 TGGCAGTGACTGTCATTAATGGG + Exonic
1145772408 17:27502945-27502967 TGGCATTGCCTGTCAGTAACTGG - Intronic
1149445531 17:56710446-56710468 TGGCATTGCCTGTAAATTCCCGG - Intergenic
1150427885 17:65091260-65091282 TGGCTTTGCTTGACAGTAAAAGG - Intergenic
1153016113 18:584028-584050 TCTCATTGACTGTCAGTCACTGG + Intergenic
1155281856 18:24248433-24248455 TGGCAATGCCTGTAAGAAAGGGG - Intronic
1164289367 19:23853534-23853556 TGGCATTGGCTGCCATTAAAAGG + Intergenic
927489952 2:23514638-23514660 TGCCATTGTCAGTCAGTAAATGG + Intronic
930372638 2:50523325-50523347 AGTCATTGCCTGTCAGTGACTGG - Intronic
933987548 2:87604388-87604410 TGGCTTTCCCTGCCAGCAACAGG - Intergenic
939134914 2:138282298-138282320 TGGCATGGCCTGGTAGTAGCAGG - Intergenic
940576864 2:155519244-155519266 AGGCATTCCCTGTCAAAAACGGG - Intergenic
941155758 2:161975955-161975977 TGGCATTGACTCTGAGTGACTGG + Intronic
948584415 2:239009947-239009969 TAGCATAGACTGTCAGTCACCGG - Intergenic
1169791424 20:9414290-9414312 TGGCAAAGGCTGTCAGTGACAGG + Intronic
1170565996 20:17605753-17605775 CTGCATTGCCTTTCAGTAAAGGG + Intronic
1174610461 20:51793952-51793974 TAGCCTTGCCTATCAATAACAGG + Intronic
1174939962 20:54915719-54915741 TGGCATTCCATGTCAGAAACTGG - Intergenic
1177431766 21:20998592-20998614 TGGGGTTGCTTGTCAGTAGCGGG + Exonic
1178152445 21:29810994-29811016 TGAAATTGCCTGTCAGTCTCAGG - Intronic
1178616941 21:34143102-34143124 TGGCAGTGCCTGGCAGTGTCGGG + Intergenic
1179805267 21:43833169-43833191 TGACATTTCCTGCCAGTCACAGG - Intergenic
1182249634 22:28989800-28989822 TGGCATTGTCTGTAAGTACGCGG - Intronic
1184173614 22:42773342-42773364 TGGCATTGCCTGGCAGCGGCGGG + Intergenic
1184251704 22:43264339-43264361 TGGCATTTCCTGTCTGTAACTGG - Intronic
949429279 3:3956609-3956631 AAGCAGTGCCTGTTAGTAACAGG - Intronic
950354468 3:12394298-12394320 ATGCACTGCCTGTAAGTAACAGG - Intronic
950810514 3:15646106-15646128 TGGAATTTTCTGTCAGTAAATGG + Intergenic
951781513 3:26368568-26368590 TGAAATTGCCTGCCAGTAAAAGG + Intergenic
953291876 3:41673423-41673445 TGGCATTTCCTTTTAGGAACTGG - Intronic
953622426 3:44544458-44544480 AGACATTGCCTGGCATTAACAGG - Intergenic
954082184 3:48218976-48218998 TGGCATTCCCTGTCTGCCACAGG + Intergenic
954735878 3:52706136-52706158 TGGCACTGCGCGTCAGTAGCCGG - Exonic
956050181 3:65239707-65239729 TGGCATTGCATGGCAGTACTTGG + Intergenic
957383116 3:79460232-79460254 TGGCAATGCCTCTCAGTAAATGG - Intronic
959610787 3:108292677-108292699 TGGCTATGCCTGTGGGTAACTGG + Intergenic
959669836 3:108963986-108964008 TGTCATTGCCTGTGAATTACTGG - Intronic
961475281 3:127142049-127142071 TGGCAATAACTGTCAGTATCGGG - Intergenic
964646067 3:158959674-158959696 TTGCTTTACCTGTCAGTATCAGG + Intergenic
969131892 4:4996206-4996228 AGGCATTGCCTCTCAGGAAAAGG - Intergenic
974204347 4:58681148-58681170 TGGCATTGCCTCTCATTACCAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
978835450 4:113144185-113144207 TGGCAATGCCTCTCAGAAACTGG + Intronic
979089563 4:116464926-116464948 TGCCATTGTCTGTCAATAAAAGG + Intergenic
981808721 4:148748694-148748716 TGGCACTGCCTATTAATAACTGG + Intergenic
983188220 4:164725314-164725336 TGTCATTGCCTAGCAGTAACCGG + Intergenic
986117858 5:4797828-4797850 TGGAATTGTCTCTCAGTAAGGGG + Intergenic
986822606 5:11483878-11483900 TGGGACTGCCTGGCAGTAAAAGG - Intronic
987858285 5:23450019-23450041 TGGTACTGCATGTCAGTAATGGG + Intergenic
987862745 5:23507462-23507484 GAGCCTTGCCTGTCAGTCACGGG - Intronic
996562829 5:124849221-124849243 TGAACTTGCCTGTAAGTAACAGG - Intergenic
1000125825 5:158243000-158243022 TGGCAGTGCCTGCTAGTAAGGGG - Intergenic
1002905079 6:1441653-1441675 TGCCATTGTCTATCAGCAACTGG - Intergenic
1007161363 6:39793786-39793808 AGGCACTGCCTGTCAATAGCTGG + Intronic
1008547640 6:52597609-52597631 TGGCCTTCCCTGTCACTAGCTGG - Intergenic
1009661256 6:66613906-66613928 AGGCAGTGTCTTTCAGTAACGGG + Intergenic
1011954485 6:93009226-93009248 AGGCATAGTCTGTCAGTAAATGG + Intergenic
1012035524 6:94133285-94133307 TGGCAGTGCTTATCAGTAGCTGG + Intergenic
1014494507 6:122104396-122104418 TGGCAGTGCCTGGCTATAACTGG + Intergenic
1021012376 7:15486252-15486274 TGGAATTTTCTGACAGTAACGGG + Intronic
1023080404 7:36521244-36521266 TGGTATTGCCTGAGAGTAAATGG + Intronic
1023986814 7:45101772-45101794 TGGCATTGCCTGAGTCTAACGGG - Intronic
1026299082 7:69081686-69081708 TGCCAGTGCCTATCAGAAACTGG - Intergenic
1026449585 7:70515836-70515858 ATGCATTGCCTGTCAGAAACTGG - Intronic
1026902540 7:74045105-74045127 TGGGACTGACTGTCAGTGACAGG - Intronic
1031121535 7:117727967-117727989 TGGCACTCCGTGTCAGTGACAGG + Intronic
1031689964 7:124775611-124775633 TGGAGTAGCCTGTCAGTGACTGG - Intergenic
1032109111 7:129060349-129060371 TGGCATTGCCTGTAGAGAACTGG - Intergenic
1035243987 7:157550575-157550597 TGGCATTTCCTGGCAGGAACAGG + Intronic
1040415800 8:47194331-47194353 TGTCATAGCCAGTCAGTCACAGG - Intergenic
1041532258 8:58882189-58882211 TGGCATTGCCTGACACTATTAGG + Intronic
1041702206 8:60803651-60803673 TGGAATTGCTTGTCAGTTACTGG + Intronic
1042476038 8:69248543-69248565 TGTCATTGACTGTTAGTGACAGG - Intergenic
1042663483 8:71180891-71180913 TGGCCTTGCCTCTCAGTTTCTGG - Intergenic
1043539780 8:81247656-81247678 TGACATTGACTGTGGGTAACTGG - Intergenic
1044188076 8:89280555-89280577 TGGCATTGCCTGAGAGAAAAAGG - Intergenic
1047435167 8:124830006-124830028 TGCCACTGCCTGTCTGTAAAGGG + Intergenic
1047774912 8:128062012-128062034 TGGCCTTGCCTGCCAGGCACTGG - Intergenic
1048596769 8:135874918-135874940 TGTCATTGCCAGTCAGTGAGTGG + Intergenic
1051384894 9:16497065-16497087 AGGCATTGCCTGGCAGGAAGGGG + Intronic
1052155163 9:25178185-25178207 TGGCTGTGACTCTCAGTAACTGG + Intergenic
1057809975 9:98250308-98250330 TGGCATTGGATGGCAGTGACCGG + Intronic
1058763706 9:108161381-108161403 GTGCATTGCCTGTCTGTAAAGGG + Intergenic
1062136233 9:134929826-134929848 TGGCATGGCCTGCCAGGAGCTGG - Intergenic
1188067551 X:25680422-25680444 TGGCTTTGGCTGTCCATAACTGG + Intergenic
1190702046 X:52996273-52996295 TGTCCTTGACTGTCAGTAATGGG + Intergenic
1192810994 X:74547325-74547347 TGGCCTTGACTGGCAGTATCTGG + Intergenic
1194538943 X:95146317-95146339 TGGAATTGCCTTTCAGCAGCTGG + Intergenic
1194666016 X:96678376-96678398 TGGCTTTGCCTGTCAATAACAGG + Intergenic
1197848719 X:130833542-130833564 TGCCATAGGCTGTCAGTAGCAGG + Intronic