ID: 1145773977

View in Genome Browser
Species Human (GRCh38)
Location 17:27513834-27513856
Sequence GGAGGACCTGTGTGATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145773977_1145773982 14 Left 1145773977 17:27513834-27513856 CCTGCTCATCACACAGGTCCTCC 0: 1
1: 0
2: 5
3: 18
4: 226
Right 1145773982 17:27513871-27513893 CGCTCAACCCCTTTAATCTTTGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145773977 Original CRISPR GGAGGACCTGTGTGATGAGC AGG (reversed) Intronic
900672732 1:3865882-3865904 GCAGCTGCTGTGTGATGAGCAGG + Exonic
900927450 1:5714514-5714536 GGAGACCCTGTGTCCTGAGCAGG + Intergenic
901132176 1:6968910-6968932 GGAGGACAGGTGTGCTGAGGTGG + Intronic
902682227 1:18051453-18051475 CGAGGACCTATGTGATATGCAGG + Intergenic
902705077 1:18199005-18199027 GGGGGACCAGTGAGATGGGCAGG - Intronic
903029026 1:20449404-20449426 GGGGGACCTGATTGATGAGGAGG - Intergenic
904485429 1:30821863-30821885 GGAGGAGCTGAGGGATGAACAGG + Intergenic
905770767 1:40636628-40636650 AGAGGACGTGTGTGGAGAGCTGG + Intronic
907774292 1:57498329-57498351 GGAGGAAGTATGTGATGAGAAGG + Intronic
910316337 1:85888175-85888197 GCAGGACCTTTTTTATGAGCAGG - Intronic
911637431 1:100250180-100250202 GTAGGACCTGAGCGATGAGTTGG + Intergenic
912280089 1:108304105-108304127 GGAGGACCTGTCTAGTGAGGAGG + Intergenic
912288137 1:108390252-108390274 GGAGGACCTGTCTAGTGAGGAGG - Intronic
912392441 1:109313483-109313505 GTGGGATCTGTGTGAGGAGCTGG + Exonic
912468538 1:109890757-109890779 GGAGGACATGAGAGAGGAGCAGG - Intergenic
912654961 1:111477746-111477768 GGAGGATCTGAGTGAGGATCTGG - Exonic
915080660 1:153349610-153349632 GCTGGAGCTGTGTGATGAGCAGG + Intergenic
918045460 1:180938499-180938521 ACAGGACCTGTGGGATGAGCCGG + Intronic
922506770 1:226130817-226130839 GGATGACCTGTGTAATGAATAGG + Intergenic
924586286 1:245363913-245363935 GGAGGACAGCTGTGAGGAGCGGG + Intronic
1063211407 10:3884339-3884361 GGAGGCTCTGATTGATGAGCAGG + Intergenic
1064062892 10:12154088-12154110 GGACGACATGTATGATGAGCCGG - Intronic
1064103831 10:12484863-12484885 GGAGGGCAGGTGTGATGACCAGG + Intronic
1064429263 10:15257240-15257262 GGAGCCCCTGTGAGATGGGCTGG + Intronic
1065458802 10:25934497-25934519 GGAGGACCTGTGTGTTTGTCGGG + Intronic
1065634404 10:27715843-27715865 AGAGGACCTATGGGATGGGCTGG + Intronic
1066310463 10:34191111-34191133 TGAGGAAGTGTGTGATGAGATGG + Intronic
1067238769 10:44473003-44473025 GGCGCACCTGTGTGGAGAGCAGG + Intergenic
1068569065 10:58608248-58608270 GGAACACCTGTGTGAAGAGTGGG + Intronic
1069890831 10:71651618-71651640 TGAGGACGTGTGTGATGTGTGGG + Intronic
1070934165 10:80280640-80280662 GTGGGAGCTGTGTGTTGAGCTGG - Intronic
1073073507 10:100809302-100809324 TGAGGCCCAGTGTGAGGAGCAGG + Intronic
1073454458 10:103628248-103628270 TGAAGACCTGGGAGATGAGCTGG - Intronic
1073498146 10:103912617-103912639 GGAGTGCCTGTGTGCAGAGCAGG + Intronic
1074529048 10:114284616-114284638 TAAGGCCCTGTGTGATGAACTGG - Intronic
1075165989 10:120069125-120069147 GGAGGACGTGTGTGTGCAGCTGG + Intergenic
1075475390 10:122729517-122729539 CGATGACCTGTGGGATGAGAAGG + Intergenic
1075655297 10:124157062-124157084 AGAGGACCTGTCTCATGAGCCGG - Intergenic
1076312191 10:129516487-129516509 GGGAGAGCTGTGTGATGAACAGG + Intronic
1076343165 10:129763998-129764020 GGATGAGCTGTGTGATGTGCCGG + Intronic
1076523116 10:131093478-131093500 GCAGGACCCGGGTGAGGAGCAGG - Intronic
1076913118 10:133402232-133402254 GCTGGCCCTGTGTGGTGAGCCGG + Exonic
1077246932 11:1544219-1544241 AGAGGCCTTGTGTGATGAGCAGG - Intergenic
1080688552 11:34536061-34536083 GGAGGACCTGAAAGATGAGTGGG - Intergenic
1080722489 11:34863381-34863403 GTAAGTCCTGTTTGATGAGCTGG - Intronic
1083256170 11:61496642-61496664 CCAGGACCTTTGTGATGGGCAGG + Intergenic
1083474076 11:62904378-62904400 TGAGGGCCTGTGTGAGGACCAGG + Intergenic
1084457148 11:69274430-69274452 GCAGCAACTGTGTGGTGAGCTGG - Intergenic
1089077841 11:115753057-115753079 GGAAGCCCTGTCTGATGAGAGGG + Intergenic
1090519263 11:127461016-127461038 GTAGGTCCCGTGTGATCAGCAGG + Intergenic
1090975834 11:131679211-131679233 GGAGGAGATGGGTGAAGAGCTGG - Intronic
1091551641 12:1539463-1539485 TGAGGACCTGTTTAATCAGCAGG - Intronic
1093885271 12:24452369-24452391 GGATGACCTCTGTGATGAAGTGG - Intergenic
1098603835 12:72365897-72365919 GGAGGCTCTGTGGGATGATCTGG + Intronic
1100151347 12:91741747-91741769 GGAAGACTTGTGTAATGAGAAGG - Intergenic
1101465279 12:104942539-104942561 GGAGGTGCTGAGTGATGAGGAGG - Intronic
1104267123 12:127244137-127244159 GGTGGACCTGCGTGATGAGCAGG + Intergenic
1104637881 12:130449369-130449391 GGAGGACCTGAGAGGTGTGCGGG + Intronic
1104668139 12:130662128-130662150 CCAGGTCTTGTGTGATGAGCGGG - Intronic
1104714837 12:131009418-131009440 GGAGGACGTGTGTGATGGTGGGG + Intronic
1105857356 13:24385533-24385555 GGAGGAGCTGTGTGCTGAGCCGG - Intergenic
1109370248 13:61413630-61413652 GGAGGCCCTGTGTGTTGAAGGGG - Exonic
1110037903 13:70712070-70712092 GAAGGAACTGTGTAATGTGCAGG - Intergenic
1110151468 13:72260006-72260028 GAAGCACCTGTTTGATGAGAGGG + Intergenic
1112665853 13:101572385-101572407 GGAGGTCCAGTGTGCAGAGCAGG + Intronic
1112897674 13:104320601-104320623 GGAGGACGTGTGAGAGGATCAGG + Intergenic
1113181909 13:107638691-107638713 GGAAGACCTCTCTGAAGAGCTGG + Intronic
1113869082 13:113547080-113547102 GGATGACCTGTCTGATGTGGTGG - Intronic
1114739831 14:25084201-25084223 TGAGGACGTGTGAAATGAGCTGG + Intergenic
1118328161 14:64795516-64795538 GGAGGACCTGGCTCAGGAGCTGG - Exonic
1118692510 14:68353449-68353471 GGAGGACTTGTGGGAAGTGCTGG + Intronic
1121884777 14:97533254-97533276 GGAGGGCCTGTGAGATGAAAGGG - Intergenic
1122789774 14:104179313-104179335 CAAGCACCTGTGTGAGGAGCTGG + Exonic
1124011816 15:25845065-25845087 GGAGAAAGTGTGTGATGAGGTGG + Intronic
1124227382 15:27905520-27905542 GGAGGTGCTGTGAGAGGAGCAGG + Intronic
1124872995 15:33562072-33562094 GGAGGCCCTGATTGATGAGGAGG + Intronic
1127774455 15:62254339-62254361 TGAGCACCTGTGGGAGGAGCTGG - Intergenic
1128156692 15:65395972-65395994 GGCCGATCTGTGTGATGACCAGG + Exonic
1128577243 15:68784409-68784431 GGAGGGCCTGGATGATGAGGAGG - Exonic
1129183172 15:73889647-73889669 GGAAGAACTATCTGATGAGCAGG + Intergenic
1129232059 15:74202511-74202533 GCAGGACCAGTGCGATGGGCGGG - Exonic
1129298265 15:74611542-74611564 GAAGGACCTGTGGGAGCAGCTGG - Intronic
1129669412 15:77598791-77598813 GGAGGGCCCCTGTGATGAGGAGG + Intergenic
1132313684 15:100875900-100875922 GGTGGAGCTGTGTGGTGGGCTGG + Intergenic
1132631308 16:918983-919005 GGAGGCCCCGTGGGAGGAGCAGG - Intronic
1133643159 16:7737392-7737414 CGAGGCCCTGTGTGGTGCGCTGG - Intergenic
1134467257 16:14490483-14490505 GGAGTCCCTGTGTGATAACCTGG + Intronic
1137926981 16:52548819-52548841 AGAGGAGCAGTGTGATGATCTGG + Intergenic
1142503953 17:351069-351091 GGAGGCCGTGGGTGATGGGCAGG - Intronic
1142765362 17:2061313-2061335 GGAGGGGCTCTGTGAGGAGCAGG + Exonic
1142955487 17:3518671-3518693 GGATGACATAGGTGATGAGCAGG + Exonic
1142982212 17:3678847-3678869 AGAGTACCTGTGCGGTGAGCAGG - Intronic
1143417418 17:6759866-6759888 GGAGAACCTGTGTTATGCGGTGG - Intronic
1144058129 17:11559301-11559323 GGAGGGCCACTGTGATGTGCGGG + Exonic
1145773977 17:27513834-27513856 GGAGGACCTGTGTGATGAGCAGG - Intronic
1145910158 17:28537644-28537666 GGGGGCCCTGGGTGAGGAGCTGG - Exonic
1148858766 17:50593290-50593312 GGAGGAGCTGAGTGAGGACCGGG + Intronic
1152231271 17:79115258-79115280 CAAGGAGCTTTGTGATGAGCAGG - Intronic
1152365664 17:79854908-79854930 GGAGGAGCTGTGGGATCAGCAGG + Intergenic
1152409644 17:80117025-80117047 GGAGCACTGGGGTGATGAGCAGG - Intergenic
1154412362 18:14148308-14148330 TGAGGACCTCTGTGCAGAGCCGG - Intergenic
1154980789 18:21500608-21500630 GGTGGACGTGTATGATGAGGAGG + Exonic
1156803698 18:41150079-41150101 GGAGGTCCTGTGAGAAGAGAGGG + Intergenic
1157598537 18:48878519-48878541 AGAGGACCTGTGGGATGAAGGGG + Intergenic
1159915436 18:74183307-74183329 GGAGGATCTGTGTGTAGAACAGG - Intergenic
1161445869 19:4318858-4318880 GGAGTACCTCTGTGGTGGGCAGG - Exonic
1161553868 19:4929437-4929459 TGAGGACATGTGGGATGAGACGG + Exonic
1161949895 19:7462171-7462193 GGAGGCTCTGTGCGATCAGCTGG - Exonic
1161984081 19:7644417-7644439 GTGGGACCTGGGTGAGGAGCAGG + Intronic
1162561738 19:11421380-11421402 GGCGGACCTGAGTGATGAGGGGG - Intronic
1162676060 19:12299202-12299224 GGAGGCCCTGTTTGTTGAGCTGG + Intergenic
1162938199 19:13992451-13992473 GCAGGACCTGTGTTGAGAGCAGG - Intronic
1163317768 19:16553293-16553315 TCAGGACCTGTGTGAAAAGCTGG - Exonic
1163536195 19:17877967-17877989 GGCCGACCTGGTTGATGAGCAGG - Exonic
1165022760 19:32937310-32937332 GGAGGACCTGTGGGATGTGCTGG - Intronic
1165737348 19:38185122-38185144 GGAGGACCTGTTTGAGGGGGTGG - Intronic
1166364630 19:42272299-42272321 GGCGGACCTGGAGGATGAGCCGG + Intronic
1166865660 19:45835222-45835244 TGAGGACCTGTGGGATGCCCAGG + Exonic
1167524945 19:49977748-49977770 GGAGGAGCTGTGTATCGAGCTGG + Intronic
1168415432 19:56164736-56164758 GAAGGAACTGGGTGATGAGCTGG - Intergenic
925195639 2:1922544-1922566 GGAGGATGGGTGTCATGAGCGGG - Exonic
926036269 2:9638287-9638309 TGAAGACCTGAGAGATGAGCAGG - Intergenic
927203102 2:20590592-20590614 AGAGGACCTGTCAGATGGGCCGG - Intronic
929927317 2:46225167-46225189 GGAGGACCTGTGTGACCAGTAGG - Intergenic
931186692 2:59959328-59959350 GGAAGGCCTGTCTGAGGAGCTGG + Intergenic
932326087 2:70862812-70862834 GGAGAATCTGTGTGGAGAGCAGG - Intergenic
932813275 2:74841959-74841981 GGAGAGGCTGTTTGATGAGCTGG + Intronic
933159995 2:79013348-79013370 GGATGACTTTTGTGATGAGACGG - Intergenic
933634416 2:84691941-84691963 AGTGGACCTGTCTGAGGAGCAGG + Intronic
933840720 2:86283942-86283964 AAATGACCTGTGTGAAGAGCAGG + Intronic
937467706 2:122149246-122149268 GGCGGTCATCTGTGATGAGCTGG + Intergenic
939656108 2:144827477-144827499 GGAGGAGCAGTGGGATGAGGGGG + Intergenic
940063365 2:149597822-149597844 CGAGGACCTGTGTTAACAGCAGG - Intergenic
941794584 2:169585149-169585171 GGAGGAGCTGTGAGCTGCGCAGG + Intronic
944997045 2:205305197-205305219 GGAGGACCAGTGACATGAGCTGG - Intronic
946640455 2:221778202-221778224 GGGGGCCCTGTGTGAAGAGGAGG - Intergenic
946708398 2:222482056-222482078 GGAGTACCTGTGTGAGAAGAGGG + Intronic
947490887 2:230593650-230593672 GGAGGAACTGTCTGAAGAGTAGG + Intergenic
948531864 2:238614069-238614091 GTAGGACCACTGTGATGAGATGG - Intergenic
1169347063 20:4836980-4837002 GGAGGTCCAATGTGAGGAGCAGG + Intergenic
1172011430 20:31848305-31848327 GGCAGACCTGGGTGATGTGCCGG + Intronic
1172884693 20:38223189-38223211 GGAGGGCCTCTCTGAAGAGCTGG - Intronic
1173386166 20:42589982-42590004 CGTGGACCTTTGTGATGGGCTGG + Intronic
1173634955 20:44547443-44547465 GCAGGCCATGTGTGGTGAGCAGG + Intronic
1173726694 20:45303488-45303510 GAAGGACCAGTGTGCTGAGGGGG - Intronic
1174454087 20:50637399-50637421 GGAGGACCTCTCTGAGGAGGTGG - Intronic
1174472752 20:50772585-50772607 GGAGGACCTCTGTGAGGAAGTGG + Intergenic
1174756081 20:53159995-53160017 GTAGGAGCTGAATGATGAGCAGG + Intronic
1176860641 21:14009949-14009971 TGAGGACCTCTGTGCAGAGCTGG + Intergenic
1176934758 21:14853651-14853673 TGAGGACCTGTGTGATTACTCGG - Intergenic
1178949831 21:36977280-36977302 GGAGGGCCTGTCTGATAGGCAGG - Intronic
1180699126 22:17772320-17772342 GGAGGCCCTGTGGGGTGGGCAGG + Intronic
1181040015 22:20187709-20187731 AGAGGGCGTGTGTGAGGAGCTGG - Intergenic
1181382306 22:22515989-22516011 AGAGTACCTGTGGGATGAGGAGG - Intronic
1182099284 22:27646415-27646437 GGAGGACCTGGGTGATGTTAGGG - Intergenic
1184100812 22:42341025-42341047 GGAGGACCTGTGTGCTAATTGGG - Intronic
1184240379 22:43208627-43208649 GGAGGACGTGGGAGATGAACTGG + Intronic
1185365912 22:50436667-50436689 TGAGGACCTCTGTGCAGAGCCGG + Intronic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
950483759 3:13260856-13260878 GGGGGTCCTCTGTGCTGAGCAGG + Intergenic
950748367 3:15108587-15108609 GGAAGAGCTGTGGGAAGAGCAGG - Intergenic
952135650 3:30416366-30416388 GAAGGATCTGAGTGAAGAGCTGG + Intergenic
952268147 3:31806740-31806762 GAAAGACCTGTGTGAGGAGGAGG + Intronic
955487506 3:59449400-59449422 GGAGGAGCTGTGGAAGGAGCTGG + Intergenic
956603903 3:71052305-71052327 CGTGTACCTGTGTGAGGAGCAGG - Intronic
957938421 3:86973701-86973723 GGAGGGCCTGTCTGATGAGCTGG - Intronic
961216411 3:125163882-125163904 TGAGGCCCTGTGGGCTGAGCTGG + Intronic
961330993 3:126137923-126137945 GAAGGAGCTGTGTGATGGCCTGG - Exonic
961830092 3:129618909-129618931 GGAGGACCCTTGAGCTGAGCCGG - Intergenic
962183803 3:133236852-133236874 GGAGGACATCTGAGATGAGAAGG - Intronic
964160121 3:153636549-153636571 GGAGGAGGTTTGTGCTGAGCAGG - Intergenic
964167473 3:153725795-153725817 AAATGACCTGTGTGATGGGCAGG - Intergenic
966818775 3:183909148-183909170 GGAGGACCTGCGTGAGGGGTGGG - Intergenic
968533938 4:1112600-1112622 GGAGGACCTGGGGGAGAAGCGGG - Intronic
968614922 4:1573454-1573476 TGAGGACCTGAGGGAGGAGCTGG - Intergenic
973174506 4:47187946-47187968 GCAGGACCTCTGTGATTAGATGG - Intronic
975207769 4:71664035-71664057 GGAGGGGCTGTGTGCTGGGCTGG + Intergenic
976824672 4:89248043-89248065 GGACGTCGTGTGGGATGAGCAGG - Exonic
978469551 4:109048169-109048191 GGAGGACCTATGGGGGGAGCAGG + Exonic
979414243 4:120417159-120417181 TGAGGACCTCTGACATGAGCTGG - Intergenic
979976471 4:127202599-127202621 GGAGGAACTGGGTGATGACAAGG - Intergenic
982846071 4:160253998-160254020 GGCAGAGCTGTGTGATGTGCTGG + Intergenic
984539378 4:181018837-181018859 GGAGGACGTGGCTAATGAGCTGG - Intergenic
984632287 4:182073710-182073732 AGAGAACCTGTGTGATGAAGTGG - Intergenic
986428976 5:7663264-7663286 GGAGTGCCTGGGTGATGAGTTGG - Intronic
988935946 5:36083125-36083147 GGAGGCCCTGTCTGGTGAGGAGG - Intergenic
992699790 5:79330335-79330357 GGAAGTCCTCTGTGAGGAGCTGG - Intergenic
993504087 5:88690751-88690773 GGAGGACCAGTGTGCTGCGGGGG + Intergenic
995052243 5:107719713-107719735 GGAGGCCCTGCGTGGTGAGAAGG - Intergenic
997589641 5:135064865-135064887 GAAGGACATGTGTGAAGAGGTGG + Intronic
999736865 5:154519348-154519370 GGAGCACCTGTGGGAAGGGCTGG - Intergenic
1001571486 5:172733206-172733228 GGAGGAACTGGGTCAGGAGCTGG + Intergenic
1002531825 5:179851476-179851498 GGAGAAGCTGGGTGATGGGCAGG + Intronic
1002590626 5:180289699-180289721 GGAGGAGCTGTGAGGAGAGCAGG - Intronic
1003403816 6:5811776-5811798 TGAGGCCCTGTGTGCTGTGCTGG + Intergenic
1005837896 6:29721628-29721650 GGAGGGCCTGAGGGATGAGAGGG + Intergenic
1005941219 6:30561830-30561852 GGAGGACCTCTGTGAAGAGCTGG - Exonic
1006063743 6:31445474-31445496 GCAGGACCTTTGTGATGCTCAGG + Intergenic
1006144570 6:31950814-31950836 GGAGGACTGGGGTGAGGAGCAGG + Intronic
1007402126 6:41608816-41608838 GGAGCACCTGTGTGAACAGGAGG + Intergenic
1007688047 6:43679060-43679082 GGAGGACATGTGGGATGGGAGGG - Intronic
1007735261 6:43978348-43978370 GGAGGACCTCAGAGATGAACAGG - Intergenic
1016319128 6:142822955-142822977 GGAGGTCCTGTGTGAGCAGGTGG - Intronic
1016950781 6:149577454-149577476 GGAGGACCAGTGAGAGGACCGGG + Intronic
1018243163 6:161798410-161798432 CGAGGACCTGTGACATCAGCAGG + Intronic
1019287715 7:231893-231915 GGCGGTCCTCTGTGCTGAGCAGG + Intronic
1019997470 7:4734045-4734067 TGAGGACATGGGTGACGAGCTGG - Intronic
1020069038 7:5213432-5213454 GGTGGTCCTGTGAGAGGAGCAGG + Intronic
1022391897 7:29950608-29950630 GGAGGAAGTGTGTGCTGATCGGG - Intronic
1022707889 7:32822644-32822666 CGAGGTCCTGTGTGACCAGCAGG - Intergenic
1022915073 7:34940696-34940718 TGAGGTCCTGTGTGACCAGCAGG + Intronic
1023792763 7:43766599-43766621 GAGGGAGCTGTGTGATGGGCAGG + Intronic
1026595574 7:71731789-71731811 GGAGCACCTTTGAGAAGAGCTGG + Intergenic
1026615326 7:71897456-71897478 GGAAGAAATGTGTGCTGAGCTGG - Intronic
1026870540 7:73848563-73848585 TGTGCACCTGTGTGATGAGCGGG + Intergenic
1028435255 7:90795880-90795902 GAAGGACCAGTGTGACAAGCAGG + Intronic
1028660130 7:93261781-93261803 GGAGGACCTGAACGAGGAGCAGG + Intronic
1030063308 7:105640254-105640276 GGAGCAGCTGTGAGATTAGCAGG - Intronic
1031084854 7:117292258-117292280 GTAGGTCCTGTGTGATGAAGAGG - Intronic
1031330097 7:120453385-120453407 GGACCACCAGTGTCATGAGCTGG - Intronic
1034664236 7:152802251-152802273 GGAGAACCTGTCTGATGTTCTGG + Intronic
1034778264 7:153852173-153852195 GGAGGAGCAGTGAGATGTGCTGG + Intergenic
1035110902 7:156480925-156480947 TGAGGAGCTGCGTGAGGAGCAGG + Intergenic
1036574606 8:10015037-10015059 AGAAGACATGTGTGATGTGCTGG - Intergenic
1036728392 8:11240501-11240523 AGAGGAAGTGTGTGAAGAGCAGG - Intergenic
1036795681 8:11754833-11754855 CGAGCACCTGTGTGATGTGATGG - Intronic
1037351999 8:17969834-17969856 GGAGGACGTTTGTGATGATTTGG + Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041453701 8:58034514-58034536 GAAGGACCTGTGTCAGGACCTGG + Intronic
1043121624 8:76332392-76332414 GCAGGACCTGGGAGATGTGCTGG - Intergenic
1048265721 8:132983943-132983965 GGAGGATCAGTGGGATGTGCAGG - Intronic
1049432316 8:142571089-142571111 GGTGGACCTCTGTGATGATGAGG + Intergenic
1049656751 8:143802469-143802491 TGTGGACCTGTGTGACCAGCAGG + Intronic
1051059507 9:13029827-13029849 GGAAGACCTTTTTAATGAGCTGG + Intergenic
1052758574 9:32566828-32566850 GCAGCTACTGTGTGATGAGCAGG - Exonic
1052866782 9:33468905-33468927 TGAGCGCCTGTGTGATGGGCAGG - Intronic
1053279314 9:36807244-36807266 GGAGGACCCGTGTGAGGAGTTGG - Intergenic
1059023295 9:110598928-110598950 GGAGGACCTGCCCCATGAGCAGG + Intergenic
1059122021 9:111648814-111648836 GGAGGTACTATGTGAGGAGCAGG + Intronic
1060048553 9:120359981-120360003 GGAGCACCAGTGTTAGGAGCTGG - Intergenic
1060419721 9:123459240-123459262 GGAGGACCTGGGGGTAGAGCAGG + Intronic
1061892635 9:133630836-133630858 GTAGGACCTTTGTGATGACATGG + Intergenic
1062451199 9:136616504-136616526 GGAGCACCCGTGTGAGGGGCTGG + Intergenic
1189942287 X:46137209-46137231 GTAGGACCTGTTTGATGAGGTGG + Intergenic
1190224250 X:48533438-48533460 GGAGGGCCTGTGAGATGAGTGGG - Intergenic
1190732078 X:53233085-53233107 GCAGGAGCTGAGTGAGGAGCTGG + Exonic
1191883651 X:65866643-65866665 GGAGGAGATGTGTGATGAAGAGG - Intergenic
1195990177 X:110674557-110674579 GGAGAACGTGTGTGATGTGCTGG + Intronic
1200152231 X:153956845-153956867 GGAGGACCTGCGTGGCGTGCTGG + Intronic
1201941557 Y:19466028-19466050 GGTGGCCCTGTGTGGAGAGCAGG - Intergenic