ID: 1145778090

View in Genome Browser
Species Human (GRCh38)
Location 17:27543418-27543440
Sequence GCCTCACACCCCTACCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 231}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145778090_1145778098 10 Left 1145778090 17:27543418-27543440 CCTGCAGGGTAGGGGTGTGAGGC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1145778098 17:27543451-27543473 CTGGGGATCCCTGCAGTTCTGGG 0: 1
1: 0
2: 4
3: 34
4: 284
1145778090_1145778091 -9 Left 1145778090 17:27543418-27543440 CCTGCAGGGTAGGGGTGTGAGGC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1145778091 17:27543432-27543454 GTGTGAGGCCTCCATGTTCCTGG 0: 1
1: 0
2: 1
3: 20
4: 177
1145778090_1145778093 -7 Left 1145778090 17:27543418-27543440 CCTGCAGGGTAGGGGTGTGAGGC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1145778093 17:27543434-27543456 GTGAGGCCTCCATGTTCCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 274
1145778090_1145778099 11 Left 1145778090 17:27543418-27543440 CCTGCAGGGTAGGGGTGTGAGGC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1145778099 17:27543452-27543474 TGGGGATCCCTGCAGTTCTGGGG 0: 1
1: 0
2: 2
3: 28
4: 247
1145778090_1145778100 12 Left 1145778090 17:27543418-27543440 CCTGCAGGGTAGGGGTGTGAGGC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1145778100 17:27543453-27543475 GGGGATCCCTGCAGTTCTGGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
1145778090_1145778097 9 Left 1145778090 17:27543418-27543440 CCTGCAGGGTAGGGGTGTGAGGC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1145778097 17:27543450-27543472 CCTGGGGATCCCTGCAGTTCTGG 0: 1
1: 0
2: 1
3: 23
4: 290
1145778090_1145778092 -8 Left 1145778090 17:27543418-27543440 CCTGCAGGGTAGGGGTGTGAGGC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1145778092 17:27543433-27543455 TGTGAGGCCTCCATGTTCCTGGG 0: 1
1: 0
2: 2
3: 16
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145778090 Original CRISPR GCCTCACACCCCTACCCTGC AGG (reversed) Intronic