ID: 1145778094 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:27543440-27543462 |
| Sequence | AGGGATCCCCAGGAACATGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 231 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 215} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1145778094_1145778105 | 28 | Left | 1145778094 | 17:27543440-27543462 | CCTCCATGTTCCTGGGGATCCCT | 0: 1 1: 0 2: 0 3: 15 4: 215 |
||
| Right | 1145778105 | 17:27543491-27543513 | GAAGAAGTCTCTTTCCTCAGTGG | 0: 1 1: 0 2: 2 3: 21 4: 233 |
||||
| 1145778094_1145778100 | -10 | Left | 1145778094 | 17:27543440-27543462 | CCTCCATGTTCCTGGGGATCCCT | 0: 1 1: 0 2: 0 3: 15 4: 215 |
||
| Right | 1145778100 | 17:27543453-27543475 | GGGGATCCCTGCAGTTCTGGGGG | 0: 1 1: 0 2: 3 3: 24 4: 292 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1145778094 | Original CRISPR | AGGGATCCCCAGGAACATGG AGG (reversed) | Intronic | ||