ID: 1145778094

View in Genome Browser
Species Human (GRCh38)
Location 17:27543440-27543462
Sequence AGGGATCCCCAGGAACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145778094_1145778105 28 Left 1145778094 17:27543440-27543462 CCTCCATGTTCCTGGGGATCCCT 0: 1
1: 0
2: 0
3: 15
4: 215
Right 1145778105 17:27543491-27543513 GAAGAAGTCTCTTTCCTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 233
1145778094_1145778100 -10 Left 1145778094 17:27543440-27543462 CCTCCATGTTCCTGGGGATCCCT 0: 1
1: 0
2: 0
3: 15
4: 215
Right 1145778100 17:27543453-27543475 GGGGATCCCTGCAGTTCTGGGGG 0: 1
1: 0
2: 3
3: 24
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145778094 Original CRISPR AGGGATCCCCAGGAACATGG AGG (reversed) Intronic