ID: 1145778096

View in Genome Browser
Species Human (GRCh38)
Location 17:27543450-27543472
Sequence CCAGAACTGCAGGGATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145778096_1145778105 18 Left 1145778096 17:27543450-27543472 CCTGGGGATCCCTGCAGTTCTGG 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1145778105 17:27543491-27543513 GAAGAAGTCTCTTTCCTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145778096 Original CRISPR CCAGAACTGCAGGGATCCCC AGG (reversed) Intronic