ID: 1145778100

View in Genome Browser
Species Human (GRCh38)
Location 17:27543453-27543475
Sequence GGGGATCCCTGCAGTTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145778090_1145778100 12 Left 1145778090 17:27543418-27543440 CCTGCAGGGTAGGGGTGTGAGGC 0: 1
1: 0
2: 0
3: 23
4: 231
Right 1145778100 17:27543453-27543475 GGGGATCCCTGCAGTTCTGGGGG 0: 1
1: 0
2: 3
3: 24
4: 292
1145778094_1145778100 -10 Left 1145778094 17:27543440-27543462 CCTCCATGTTCCTGGGGATCCCT 0: 1
1: 0
2: 0
3: 15
4: 215
Right 1145778100 17:27543453-27543475 GGGGATCCCTGCAGTTCTGGGGG 0: 1
1: 0
2: 3
3: 24
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145778100 Original CRISPR GGGGATCCCTGCAGTTCTGG GGG Intronic