ID: 1145778101

View in Genome Browser
Species Human (GRCh38)
Location 17:27543459-27543481
Sequence ACACAGCCCCCAGAACTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145778101_1145778107 26 Left 1145778101 17:27543459-27543481 CCCTGCAGTTCTGGGGGCTGTGT 0: 1
1: 0
2: 3
3: 25
4: 326
Right 1145778107 17:27543508-27543530 CAGTGGCACGTGCTTCTCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 202
1145778101_1145778105 9 Left 1145778101 17:27543459-27543481 CCCTGCAGTTCTGGGGGCTGTGT 0: 1
1: 0
2: 3
3: 25
4: 326
Right 1145778105 17:27543491-27543513 GAAGAAGTCTCTTTCCTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145778101 Original CRISPR ACACAGCCCCCAGAACTGCA GGG (reversed) Intronic