ID: 1145778105

View in Genome Browser
Species Human (GRCh38)
Location 17:27543491-27543513
Sequence GAAGAAGTCTCTTTCCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145778094_1145778105 28 Left 1145778094 17:27543440-27543462 CCTCCATGTTCCTGGGGATCCCT 0: 1
1: 0
2: 0
3: 15
4: 215
Right 1145778105 17:27543491-27543513 GAAGAAGTCTCTTTCCTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 233
1145778096_1145778105 18 Left 1145778096 17:27543450-27543472 CCTGGGGATCCCTGCAGTTCTGG 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1145778105 17:27543491-27543513 GAAGAAGTCTCTTTCCTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 233
1145778095_1145778105 25 Left 1145778095 17:27543443-27543465 CCATGTTCCTGGGGATCCCTGCA 0: 1
1: 0
2: 1
3: 26
4: 254
Right 1145778105 17:27543491-27543513 GAAGAAGTCTCTTTCCTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 233
1145778101_1145778105 9 Left 1145778101 17:27543459-27543481 CCCTGCAGTTCTGGGGGCTGTGT 0: 1
1: 0
2: 3
3: 25
4: 326
Right 1145778105 17:27543491-27543513 GAAGAAGTCTCTTTCCTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 233
1145778102_1145778105 8 Left 1145778102 17:27543460-27543482 CCTGCAGTTCTGGGGGCTGTGTC 0: 1
1: 0
2: 1
3: 44
4: 497
Right 1145778105 17:27543491-27543513 GAAGAAGTCTCTTTCCTCAGTGG 0: 1
1: 0
2: 2
3: 21
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145778105 Original CRISPR GAAGAAGTCTCTTTCCTCAG TGG Intronic