ID: 1145778107

View in Genome Browser
Species Human (GRCh38)
Location 17:27543508-27543530
Sequence CAGTGGCACGTGCTTCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145778103_1145778107 3 Left 1145778103 17:27543482-27543504 CCTTTACCTGAAGAAGTCTCTTT 0: 1
1: 0
2: 0
3: 20
4: 301
Right 1145778107 17:27543508-27543530 CAGTGGCACGTGCTTCTCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 202
1145778101_1145778107 26 Left 1145778101 17:27543459-27543481 CCCTGCAGTTCTGGGGGCTGTGT 0: 1
1: 0
2: 3
3: 25
4: 326
Right 1145778107 17:27543508-27543530 CAGTGGCACGTGCTTCTCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 202
1145778102_1145778107 25 Left 1145778102 17:27543460-27543482 CCTGCAGTTCTGGGGGCTGTGTC 0: 1
1: 0
2: 1
3: 44
4: 497
Right 1145778107 17:27543508-27543530 CAGTGGCACGTGCTTCTCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 202
1145778104_1145778107 -3 Left 1145778104 17:27543488-27543510 CCTGAAGAAGTCTCTTTCCTCAG 0: 1
1: 0
2: 3
3: 28
4: 274
Right 1145778107 17:27543508-27543530 CAGTGGCACGTGCTTCTCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145778107 Original CRISPR CAGTGGCACGTGCTTCTCCT TGG Intronic