ID: 1145779188

View in Genome Browser
Species Human (GRCh38)
Location 17:27550819-27550841
Sequence TCTAGTCTTGAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 305}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145779185_1145779188 5 Left 1145779185 17:27550791-27550813 CCGTGGCTAAGACTAAGGGTTGA 0: 1
1: 0
2: 0
3: 14
4: 110
Right 1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 305
1145779183_1145779188 7 Left 1145779183 17:27550789-27550811 CCCCGTGGCTAAGACTAAGGGTT 0: 1
1: 0
2: 1
3: 6
4: 123
Right 1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 305
1145779180_1145779188 21 Left 1145779180 17:27550775-27550797 CCGAGGGCTAGCTTCCCCGTGGC 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 305
1145779178_1145779188 22 Left 1145779178 17:27550774-27550796 CCCGAGGGCTAGCTTCCCCGTGG 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 305
1145779184_1145779188 6 Left 1145779184 17:27550790-27550812 CCCGTGGCTAAGACTAAGGGTTG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145779188 Original CRISPR TCTAGTCTTGAGAAGGAGGA TGG Intronic
900719448 1:4165814-4165836 TCAAGGCCTGAGAAGCAGGAAGG - Intergenic
901379165 1:8861424-8861446 TCAATTCTTGGGAAGGAGAAAGG + Exonic
901530770 1:9851151-9851173 GCGAGTCTTGAGAAGAAAGAGGG - Intronic
903004497 1:20289746-20289768 TCTTGTGTGGAGAAGGAGGTAGG + Intergenic
903926061 1:26831616-26831638 TCTAGCCCTAAGATGGAGGAGGG + Intronic
904738670 1:32654695-32654717 TGTTGTTTTGAGACGGAGGACGG + Intronic
904821824 1:33250257-33250279 AGTAGTCTTGAGAGGGAGGCTGG - Intergenic
905370496 1:37480216-37480238 CCTAGGCCTGAGCAGGAGGAGGG - Intronic
905489368 1:38331687-38331709 TCAAGTGCTGAGGAGGAGGAAGG - Intergenic
905684427 1:39898645-39898667 TCTAGTCCAGGGAAGGAGGTGGG - Intronic
906118740 1:43373273-43373295 TCTCTTCTTGAGAAAGAGGATGG - Intergenic
906281766 1:44559503-44559525 TATAGAGATGAGAAGGAGGAAGG + Intronic
906733044 1:48099609-48099631 ACAAGTCTTGAGAAAGGGGAAGG + Intergenic
906915002 1:49999549-49999571 TCTAGTTTTGTGAAGAATGATGG - Intronic
907817548 1:57935156-57935178 TCTTGCCATGAGAAGAAGGAGGG + Intronic
908297489 1:62727585-62727607 TCTAAACTTGAAGAGGAGGAGGG - Intergenic
908800424 1:67874394-67874416 TTTAGCCTTGAGCAGGAGTAGGG + Intergenic
909466934 1:75983000-75983022 TCTGGTGTTGTGCAGGAGGAGGG + Intergenic
909861524 1:80611692-80611714 ACAAGTCTGGAGCAGGAGGAAGG + Intergenic
910053541 1:83004970-83004992 TCAAGTCAGGAGAAGGAGAAAGG + Intergenic
911302944 1:96198141-96198163 TCTTGTGTTGAATAGGAGGAGGG + Intergenic
911439490 1:97907861-97907883 TCTAGACTTGAGAATGAGTGAGG - Intronic
911556171 1:99347394-99347416 TCTAGTCTTCCAAAGGAGAAAGG - Intergenic
911922906 1:103789847-103789869 TATAGTCTAGAGAGGGAGAAAGG - Intergenic
912270266 1:108200960-108200982 ACCCATCTTGAGAAGGAGGAGGG - Intergenic
913127388 1:115805426-115805448 TCCTGTCTTGAGAAGAGGGAGGG + Intergenic
914449338 1:147776894-147776916 TCTATTGTATAGAAGGAGGAGGG - Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
914688172 1:150001078-150001100 TCATTTCTTGAGAAAGAGGAAGG + Intronic
915563330 1:156700271-156700293 TCCTGGCTTGAGGAGGAGGACGG - Intronic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
917325191 1:173824743-173824765 TCGAGTCTTCTGAAAGAGGAAGG - Exonic
917402661 1:174667990-174668012 TGTAGTCCAGAGCAGGAGGAGGG + Intronic
918529844 1:185506327-185506349 TCTAGTTCTGTGAAGAAGGACGG + Intergenic
919851548 1:201676368-201676390 TTCAGTCTTGGGAAGGAGAAAGG - Intronic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
921423720 1:214978277-214978299 TCTTCTCTTGAGCAGGAGGCAGG - Intergenic
923921540 1:238569895-238569917 TTTAACCTTGAGAAGGAGGAAGG + Intergenic
924657490 1:245986303-245986325 TCTAGTCATTAGAAGAATGAAGG + Intronic
924719533 1:246609205-246609227 TCTAGTGTTGAGGAAAAGGAAGG + Intronic
924877779 1:248124629-248124651 TCTAGTTTTGTGAAGAATGATGG + Intergenic
924894549 1:248321851-248321873 TCTAGTTTTGTGAAGAATGATGG - Intergenic
1063503822 10:6579287-6579309 ACTAGGCTGGAGAAGGTGGAGGG - Intronic
1064409202 10:15090815-15090837 TCTTGTCTTGAGATGCAAGAAGG + Intergenic
1065476704 10:26146021-26146043 TCTCTTCTTGAAAGGGAGGAGGG - Intronic
1067035484 10:42912648-42912670 TTGAGTCTTGATAAGGATGAAGG + Intergenic
1067371593 10:45688810-45688832 TCTAGTTCTGTGAAGAAGGATGG + Intergenic
1067388190 10:45837338-45837360 TCTAGTTCTGTGAAGAAGGATGG - Intronic
1067446075 10:46347264-46347286 TCTAGTTCTGTGAAGAAGGATGG + Intergenic
1067503291 10:46826505-46826527 TCTAGTTCTGTGAAGAAGGATGG + Intergenic
1067591304 10:47513506-47513528 TCTAGTTCTGTGAAGAAGGATGG - Intronic
1067638421 10:48021599-48021621 TCTAGTTCTGTGAAGAAGGATGG - Intergenic
1067875068 10:49998736-49998758 TCTAGTTCTGTGAAGAAGGATGG + Intronic
1067985567 10:51140030-51140052 TCTAGTTTGGAGAAGGAAGCTGG - Intronic
1068099230 10:52531283-52531305 TCTAGTCCTGTGAAGAATGATGG - Intergenic
1069305465 10:66963711-66963733 TCTATTCATGAGAAAGAGCAGGG + Intronic
1069778989 10:70943169-70943191 TGTAGTTTTGAGTGGGAGGAGGG + Intergenic
1070112215 10:73496853-73496875 TGTATTATTGAGCAGGAGGATGG - Intergenic
1070135025 10:73686025-73686047 TCTAGTTCTGTGAAGAAGGATGG - Intronic
1073767840 10:106702909-106702931 AGTAGACTTGAAAAGGAGGAAGG + Intronic
1074446069 10:113521928-113521950 TATAGTTTTGCGAAGGAGGAAGG - Intergenic
1085001491 11:73040469-73040491 ACAAGACTTGGGAAGGAGGATGG - Intronic
1086067176 11:82757774-82757796 TCTAATTTTGAGAAGGAGATAGG + Intergenic
1086598775 11:88607144-88607166 TCTAGTCCTGAGATGGAAGCAGG - Intronic
1086844782 11:91735053-91735075 TCTAGTTTTGTGAAGAATGATGG - Intergenic
1087139410 11:94750665-94750687 TCAGGGCTTGAGGAGGAGGATGG - Intronic
1087224806 11:95586643-95586665 GTTAGTATTGAGAATGAGGAAGG - Intergenic
1088908390 11:114171796-114171818 TATAATGTTGAGATGGAGGAAGG - Intronic
1088924858 11:114291455-114291477 GCAAGGCTTGAGGAGGAGGAAGG + Intronic
1089532037 11:119136331-119136353 TCTAGTCTTGGTTAGGTGGAAGG - Intergenic
1090019376 11:123113646-123113668 TCTGGTGGTGGGAAGGAGGATGG + Intronic
1090483563 11:127090138-127090160 TCTAGTTCTGTGAAGAAGGATGG - Intergenic
1091131257 11:133148953-133148975 TTCAGTCTTGAGAAGGAGAGAGG + Intronic
1091184256 11:133633617-133633639 TCAAGTCTTGGGGAAGAGGATGG - Intergenic
1091223088 11:133942155-133942177 TTTCCTCTCGAGAAGGAGGATGG + Intronic
1092269135 12:7008380-7008402 TCTGTGCTTGAGAAGAAGGATGG + Intronic
1092768919 12:11878805-11878827 TCTAGAATAGAGGAGGAGGAGGG + Intronic
1093647887 12:21609877-21609899 TCTAGACTAGAGAAGGTGGCTGG + Intergenic
1093733100 12:22588315-22588337 TTTAGGCTGGAGAAAGAGGAAGG + Intergenic
1093916288 12:24805776-24805798 TCCAGGCTTGAGAAGGTGGTTGG + Intergenic
1094132303 12:27087342-27087364 TGAAGGCTTGAGAAGCAGGAGGG - Intergenic
1096061962 12:48708966-48708988 TGTAGTCTTGGTAAGGTGGAAGG + Intronic
1097278397 12:57828735-57828757 CCTGGTCTTGAGAAAAAGGAAGG + Intronic
1098244383 12:68501217-68501239 TCTAGAGTAGAAAAGGAGGAGGG + Intergenic
1101842453 12:108337945-108337967 ATTGGTCTTGAGAAGGAGGTAGG + Intronic
1103364514 12:120371408-120371430 TCTCTTCTGGAGAAGGATGAAGG - Intergenic
1104292297 12:127481764-127481786 TCTTGTCTTGGGAAGGAGATGGG + Intergenic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1108391099 13:49948517-49948539 TCTAGTTCTGTGAAGAAGGATGG - Intergenic
1109196925 13:59388147-59388169 TCTAGTTTTGTGAAGGATGATGG + Intergenic
1109200991 13:59430707-59430729 TCTAGTTTTGTGAAGAACGATGG + Intergenic
1110066245 13:71110036-71110058 TCCAATCTTGGTAAGGAGGAGGG + Intergenic
1111223433 13:85237810-85237832 TTTAGTCTTGAGAAAGAATATGG - Intergenic
1111581390 13:90228279-90228301 TCTACTCTAGTGAAGGAGTAGGG + Intergenic
1112087362 13:96045955-96045977 TCTAGTTTTGTGAAGAATGATGG - Intronic
1115301622 14:31892100-31892122 TCTAAACTTCAGAATGAGGAGGG + Intergenic
1115425519 14:33254422-33254444 CCAAGTCTTAAGAATGAGGATGG - Intronic
1116715323 14:48418636-48418658 TCCACTCTTGTGAAGGTGGAAGG + Intergenic
1119222339 14:72919210-72919232 TCTAGACTAGAGAATGAGGAGGG - Intergenic
1119776578 14:77252904-77252926 TCCACTCTAGAGAAGGAGAATGG + Intronic
1120424862 14:84334433-84334455 TAGAGTCTTGAGAGGGAGCAGGG - Intergenic
1120450586 14:84661735-84661757 TCTAGTTTTGTGAAGAATGATGG + Intergenic
1122855868 14:104559851-104559873 TCAAGTCTTGGGGAAGAGGAGGG - Intronic
1124171848 15:27381330-27381352 TCATGCCTTCAGAAGGAGGAGGG - Intronic
1124274000 15:28310563-28310585 TCTAGTCTTCAGTCAGAGGAGGG + Intronic
1125587470 15:40831017-40831039 TCTCTTCCTGAGCAGGAGGAGGG + Intergenic
1128614613 15:69099433-69099455 TCTTGTCCTGTGAAGGGGGATGG + Intergenic
1130048537 15:80464590-80464612 TCTCTCCTTGAGAAGGAGGTAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130235064 15:82125757-82125779 TCTAGGCCTGGGAAGGAGGATGG - Intergenic
1130405828 15:83600712-83600734 TCTAGTTTTGTGAAGAATGATGG + Intronic
1131669161 15:94600745-94600767 TCTATTCTGGAGGAGGGGGAAGG - Intergenic
1131856713 15:96605143-96605165 TGAAGTCTTGAGCAGAAGGAAGG + Intergenic
1132781352 16:1627922-1627944 TACAGTCTTGCCAAGGAGGAAGG - Intronic
1133686980 16:8174771-8174793 TCAAGTATGTAGAAGGAGGATGG - Intergenic
1134101611 16:11456490-11456512 ACAAGGCTGGAGAAGGAGGAAGG + Intronic
1134108483 16:11500199-11500221 TCTGGTCTCTATAAGGAGGATGG - Intronic
1134324021 16:13190336-13190358 TTTAGTCTTTAGAATGATGATGG + Intronic
1138257415 16:55578523-55578545 TCTGGGTTTGAGAAGCAGGAAGG - Intronic
1139580311 16:67869393-67869415 ATAGGTCTTGAGAAGGAGGAAGG - Intronic
1141364705 16:83432007-83432029 GATAGACTGGAGAAGGAGGAAGG + Intronic
1141997310 16:87643734-87643756 TCTAGCCATGAGAAGCAGGATGG + Intronic
1142265897 16:89063854-89063876 GCCAGTCCAGAGAAGGAGGAAGG + Intergenic
1142960277 17:3548186-3548208 TGTAGTCTTGTGAGGAAGGAAGG - Intronic
1143318277 17:6049518-6049540 TCTAGTGTAGAGAAGGAGGGAGG - Intronic
1145278729 17:21453408-21453430 TTAAAGCTTGAGAAGGAGGAGGG + Intergenic
1145288575 17:21524271-21524293 TCCAGTCATGTGAGGGAGGATGG + Intergenic
1145389086 17:22442158-22442180 TCCAGTCATGTGAGGGAGGATGG - Intergenic
1145399123 17:22517077-22517099 TTAAAGCTTGAGAAGGAGGAGGG - Intergenic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145766405 17:27460944-27460966 TCTAGTCTAGTGAAGGAGCCAGG + Intronic
1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG + Intronic
1146887468 17:36482315-36482337 TTTAGTCTAGAGTTGGAGGATGG + Intergenic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1149381461 17:56098183-56098205 TAGAGCCTAGAGAAGGAGGATGG + Intergenic
1149757710 17:59201335-59201357 TCTAGGCAAGAGAAGGAGAAAGG + Intronic
1153397650 18:4642682-4642704 TATAGTCTTGAGAACTGGGAAGG + Intergenic
1155216249 18:23645592-23645614 TCTAATCTAGAGAAGCAGAAGGG - Intronic
1158467168 18:57701095-57701117 GCGAGCCTTGAGAAGGAAGATGG + Exonic
1158551546 18:58440248-58440270 TCCTGTCCTGAGAAGGAGAAGGG - Intergenic
1159550420 18:69889769-69889791 TATAGGATTGACAAGGAGGAAGG - Intronic
1159881909 18:73866041-73866063 TATAGTCTTGATAATTAGGAAGG - Intergenic
1160071040 18:75628037-75628059 TCATGTCTGGAGCAGGAGGAAGG + Intergenic
1161469380 19:4448642-4448664 TCTAGCCTTGAGAAGGCGGAAGG - Intronic
1161930080 19:7333561-7333583 TCAAGTCTAGAGAATGAGAAGGG + Intergenic
1164799751 19:31066899-31066921 TCTGGTCTTGAGGAGAAGGGAGG + Intergenic
925252623 2:2452972-2452994 TCAATTCATGAGGAGGAGGAAGG + Intergenic
926272992 2:11381332-11381354 TTTACTTTTGAGAAGGAGGAAGG - Intergenic
926714193 2:15911031-15911053 TCCAGTTTGGAGAAGGAGGATGG + Intergenic
928914443 2:36456485-36456507 ACTAGTTTGGAAAAGGAGGAAGG - Intronic
929303643 2:40334565-40334587 TCTACCCTGGAGAAGGAAGAAGG + Intronic
931233025 2:60390377-60390399 CCTAGTCATGAAAATGAGGATGG - Intergenic
931536225 2:63280086-63280108 TCTAGTTTTGTGAAGAATGATGG - Intronic
932062490 2:68520839-68520861 TCTAGTCCTGTGAAGAATGATGG + Intronic
935581541 2:104759938-104759960 TCAAGTTTTGAGAAAAAGGAAGG + Intergenic
936806968 2:116345984-116346006 TGTAGTCTTCAAAAGGAGGCAGG - Intergenic
936972222 2:118186627-118186649 TCCAGTCACGAGAAGGAGGGAGG - Intergenic
937751784 2:125484250-125484272 TCTAGTCTTGTGAAGAATGATGG + Intergenic
937879219 2:126852448-126852470 TGGAGGCTTGAGAAGGGGGAGGG - Intergenic
937971597 2:127553281-127553303 TCTAGTTCTGAGAAGAATGATGG + Intronic
942751355 2:179291635-179291657 TCTATGCTTGAGTAAGAGGAGGG - Intergenic
944654769 2:201866618-201866640 TCTTGTCTTTGGAAGGAGAAGGG + Intronic
945683791 2:212944699-212944721 TCTAGTCTTATGAAGTAGAAAGG - Intergenic
946650717 2:221890636-221890658 TCTAGTCTTGACAAAGGGCAGGG + Intergenic
948216369 2:236236580-236236602 GCCAGTCTTGAGAAAGAGGAAGG - Intronic
1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG + Intergenic
1170044232 20:12068440-12068462 TCAAGTCTTAGGAAGGAGAATGG + Intergenic
1171470472 20:25366618-25366640 TAAAGTCTTGAAATGGAGGAGGG - Intronic
1172304695 20:33872458-33872480 TCCAGGCTGGAGAAGGAGCAAGG + Intergenic
1174973189 20:55301586-55301608 TCTAGACTGGGGAAGCAGGAAGG + Intergenic
1177291008 21:19111320-19111342 TCTAGTTTTGACTGGGAGGAAGG + Intergenic
1177661545 21:24090096-24090118 TCTAGTCCTGTGAAGAATGATGG - Intergenic
1177770197 21:25505396-25505418 TCTAGTCTTAAGATAGAGAAAGG + Intergenic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178191992 21:30293924-30293946 TATAGTTGTGAGAATGAGGAAGG - Intergenic
1178546084 21:33494013-33494035 ACTGGTATTGGGAAGGAGGATGG - Intergenic
1178900997 21:36598530-36598552 TCTACTCTGGAGACAGAGGAAGG - Intergenic
1179145804 21:38766375-38766397 TACAGTCTTCAGAAGGAGCAAGG + Intergenic
1179596557 21:42446493-42446515 TCTAGACATTAGAAAGAGGAAGG + Intronic
1182234425 22:28864367-28864389 TCTAGTCTTTGGAGGGAGGATGG + Intergenic
1182695053 22:32192862-32192884 TCTGGTCTTGGGAAGGGGGCAGG + Intronic
1182716301 22:32358462-32358484 TCTGGTCTTGGGAAGGGGGCAGG - Intronic
949945267 3:9184999-9185021 ACTAGTCTGGGGAGGGAGGATGG - Intronic
950201994 3:11050984-11051006 TCTGGTATTGAGGAGGAGGAGGG - Intergenic
950266462 3:11576843-11576865 CCTAGTCTTGAGTTGGTGGATGG - Intronic
950461515 3:13124990-13125012 TGTGGACTGGAGAAGGAGGATGG - Intergenic
951941725 3:28086826-28086848 TTTAGTCTAAAGAAGGAGAAAGG - Intergenic
952994158 3:38861361-38861383 TCTAGTCCTGTGAAGGATGACGG - Intronic
953071079 3:39520480-39520502 TGCAGTCCAGAGAAGGAGGAGGG + Intronic
954392507 3:50274996-50275018 CCGAGTCCTGAGAGGGAGGAGGG - Exonic
954563251 3:51576565-51576587 TTTAGTCTTGGGAGGGTGGATGG + Intronic
955949975 3:64233335-64233357 TGTAGTCTTGAGCAGAAGCATGG - Intronic
959080386 3:101794692-101794714 TCTTGGGTAGAGAAGGAGGAAGG + Intronic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
962004526 3:131334892-131334914 TTTAGTCTTGGGAAGGTGTATGG - Intronic
962026343 3:131551702-131551724 TCTCTTCTTGTCAAGGAGGAAGG - Intronic
962147077 3:132851096-132851118 TCTAGTTTTGTGAAGAATGATGG + Intergenic
962502996 3:136014339-136014361 TCTAGTTTTGTGAAGAGGGATGG + Intronic
962623856 3:137205357-137205379 TATAATCTTGAGAAGCAAGAAGG + Intergenic
965014903 3:163145507-163145529 TCTAGTTTTGTGAAGAAGGATGG + Intergenic
966076882 3:175946968-175946990 TCTAGTTGTGTGTAGGAGGATGG + Intergenic
966441803 3:179953585-179953607 TTTTGTTTTGAGAAGCAGGAGGG + Intronic
966528979 3:180952553-180952575 TGTCTTGTTGAGAAGGAGGAGGG + Intronic
967336695 3:188352088-188352110 TTAAGTCAGGAGAAGGAGGAAGG - Intronic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
971607734 4:28680176-28680198 TCTAGACTTTAGCAGCAGGAAGG - Intergenic
972163029 4:36248143-36248165 GAAAGTCTTGAGAAGGAGGTAGG - Intergenic
972219618 4:36939037-36939059 TTTAGTCTTGGGAAGGTGTATGG - Intergenic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972426536 4:38938253-38938275 TCTTGGCCTGAGGAGGAGGAGGG - Intronic
975301245 4:72793750-72793772 TCTAGTTCTGTGAAGAAGGATGG - Intergenic
977836647 4:101653206-101653228 TCTAGTCATGAGAAAAAGAAAGG + Intronic
978589038 4:110304151-110304173 ACTATCCTTGAGCAGGAGGAGGG + Intergenic
979426155 4:120570488-120570510 TCTACTAATGTGAAGGAGGAGGG - Intergenic
979711229 4:123781829-123781851 TCTGATCTTTAGGAGGAGGAAGG + Intergenic
979826226 4:125236241-125236263 TCTAGCCCTGTGAAGGAGCAGGG + Intergenic
981618711 4:146669924-146669946 TCTACTCTGGAGGATGAGGAAGG - Intergenic
982628621 4:157802223-157802245 TCTAGTTTTGTGAAGAATGATGG + Intergenic
984005183 4:174297553-174297575 TCTATGCTAGAGAAGGTGGATGG - Intronic
984246667 4:177283205-177283227 TCTTATCTTGAGAAGGATGCTGG - Intergenic
984464289 4:180078045-180078067 TTTAGGCTTGTGAAGGAGGCTGG + Intergenic
985382931 4:189414257-189414279 TCTAGTCTTCAGAAACAGGTGGG - Intergenic
985729442 5:1539169-1539191 TGTAGGCTTGGGAAGGATGATGG - Intergenic
987563902 5:19560132-19560154 TCTAGTTTTGTGAAGAATGATGG - Intronic
988632921 5:32950412-32950434 CCTAGTAATGTGAAGGAGGACGG + Intergenic
989530266 5:42499775-42499797 TCTTTTTTTGAGAAGGAGAAAGG + Intronic
990162739 5:52961053-52961075 TCTAATCTTGTGAAGGAGACAGG + Intergenic
992120401 5:73586532-73586554 TCTAGCCATGATACGGAGGATGG - Intergenic
993086993 5:83375357-83375379 CCTAGTCTTTAGCAGAAGGAAGG - Intergenic
994953488 5:106497221-106497243 TCCAGGCTGGAGAAGGGGGATGG - Intergenic
995078241 5:108013604-108013626 TCTTGTGTTGAGAAAGAAGACGG - Intronic
995095318 5:108229175-108229197 TCTAGTTTTGTGAAGAATGATGG - Intronic
995181027 5:109230359-109230381 ACTAGCCTTGTAAAGGAGGAGGG + Intergenic
996198194 5:120636246-120636268 TCTAGTTTTGTGAAGAATGATGG - Intronic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
998746463 5:145265437-145265459 TCTAGTTGTGTGAAGAAGGATGG - Intergenic
999684258 5:154088422-154088444 TCTGGTGTGGAGAAGGAGGGGGG - Intronic
1000132990 5:158318027-158318049 TGTAGTCTTAGGAAGGAGAAAGG - Intergenic
1000895721 5:166853263-166853285 TCTATTCTTGGGAAGGAAGGAGG + Intergenic
1002091159 5:176807320-176807342 TCATGTCAGGAGAAGGAGGAGGG - Intergenic
1003552944 6:7115158-7115180 TCTCCTCTTGAGAGGGTGGATGG + Intronic
1004324746 6:14664676-14664698 TCTAGATTTGAGGATGAGGACGG + Intergenic
1004744832 6:18499434-18499456 TTGAGTGCTGAGAAGGAGGAGGG + Intergenic
1005307565 6:24528711-24528733 TTTTTTCTTGAGATGGAGGATGG + Intronic
1006602310 6:35234121-35234143 TTTAGTGCTGAGAAGGATGATGG + Intronic
1008446400 6:51597482-51597504 TCTAGTTCTGTGAAGGATGATGG - Intergenic
1011661916 6:89602155-89602177 TCCAGCCTTGAAAGGGAGGATGG - Intronic
1012082763 6:94782160-94782182 TTTAGTCTTGAGAGGGTGTATGG + Intergenic
1012786561 6:103636084-103636106 TCTAGTTTTGTGAAGAATGATGG - Intergenic
1012931868 6:105325897-105325919 TCTGGACTTGAGAAGGAGGCAGG + Intronic
1013839923 6:114379218-114379240 TGTAGCCTTGAGAACCAGGAAGG - Intergenic
1013996387 6:116313228-116313250 TGTAGGCTTCAGAAGGAGCATGG + Intronic
1014421350 6:121249952-121249974 TCTAGTTTTGTGAAGAATGATGG - Intronic
1014444906 6:121515736-121515758 TCTAGACTTGGTAAGGATGAAGG + Intergenic
1014515562 6:122374308-122374330 TCTAGTCTTGGAAAAGAGAATGG - Intergenic
1014915051 6:127136441-127136463 TCTATTCCTGGGAATGAGGAAGG + Intronic
1015375050 6:132500901-132500923 TTTCACCTTGAGAAGGAGGAAGG - Intronic
1015796976 6:137022907-137022929 TCTAGTCTTCAGAAGGAGTGTGG + Intronic
1020502972 7:8946270-8946292 TCTAATCTTGAGAAATAAGATGG + Intergenic
1022751919 7:33237971-33237993 TCTATTCTTGAGGATGAGGGAGG - Intronic
1023623599 7:42095814-42095836 TCTAGCCTGGAGATGGAGGCGGG + Intronic
1024228851 7:47348719-47348741 TTTGATCTGGAGAAGGAGGATGG + Intronic
1024709038 7:51995295-51995317 TGTACTCTGGGGAAGGAGGAAGG + Intergenic
1026212995 7:68323468-68323490 TCTGGTCTTGAGAGGGAGCAGGG - Intergenic
1026292913 7:69024897-69024919 TGTAGTCTTGGGCAAGAGGAAGG - Intergenic
1028248229 7:88508740-88508762 TGAAATCTTGAGAAGGAGGATGG + Intergenic
1028470481 7:91201113-91201135 TCTACATTTGAGAAGGAGGTTGG + Intronic
1030732813 7:113009601-113009623 TCTACTCTCAAGAAAGAGGAGGG - Intergenic
1031200033 7:118670628-118670650 TTTTTTCTTGAGACGGAGGACGG + Intergenic
1032278552 7:130482243-130482265 TATAGTCTAGATAAGGAGCAAGG - Intergenic
1032690633 7:134283162-134283184 TGTAGCCTTGAGGTGGAGGAAGG - Intergenic
1033425861 7:141243622-141243644 GCTGGATTTGAGAAGGAGGAAGG - Intronic
1033794661 7:144833473-144833495 TTTTGTTTTGAGATGGAGGATGG + Intronic
1034194808 7:149238517-149238539 TTGAGTATTGAGATGGAGGATGG + Intergenic
1034376752 7:150651979-150652001 TCTAATCTTGTGAAGAATGATGG + Intergenic
1036793863 8:11741696-11741718 TCTAATCTTGACAATGATGAAGG + Intronic
1037648155 8:20812542-20812564 TCTAGTCTTCAGAAGTGTGAGGG + Intergenic
1037757363 8:21719779-21719801 TCTACTCATGAGCAGGAGGGAGG - Intronic
1037881174 8:22574177-22574199 TCGTGTCTTGAAGAGGAGGAGGG - Intronic
1038143699 8:24873937-24873959 TCTAGTTTTGTGAAGAATGATGG - Intergenic
1038770594 8:30475721-30475743 TCTAGTGTTGGGGAGGAGGAAGG + Intronic
1038974851 8:32683670-32683692 TCTAATCTTAAAAAGTAGGAAGG - Intronic
1039847703 8:41337433-41337455 TGTAGTCCTGAGAAGGTGAAAGG - Intergenic
1041536640 8:58933711-58933733 GCTAGTCCTGAGAAGGATCATGG + Intronic
1041602822 8:59741453-59741475 ACTTGTCTTGAGAAGGATAATGG - Intergenic
1041857502 8:62475071-62475093 TGTAGTTTTGGGAGGGAGGAGGG - Intronic
1044700275 8:94959350-94959372 TCAAGGCTTGAAGAGGAGGAAGG + Intronic
1045121830 8:99046067-99046089 TCTAGTTCTGTGAAGGATGATGG + Intronic
1047448753 8:124943672-124943694 TCTGGACTTGAGAAGCAGAAAGG - Intergenic
1047706370 8:127503656-127503678 TTTATTCCTAAGAAGGAGGAAGG + Intergenic
1048656906 8:136549470-136549492 TTTAATCTTGTGAAGAAGGAAGG + Intergenic
1049322855 8:142006208-142006230 CCTGGGCTTGAGAAGAAGGAAGG - Intergenic
1049408137 8:142460733-142460755 TCTGGCCTGGAGAGGGAGGAGGG - Intronic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050442531 9:5680559-5680581 TTTAGTCTTGGGAAGGTGTAGGG + Intronic
1050518839 9:6475948-6475970 TCTAGTATTCAGAAGCACGATGG - Intronic
1051741056 9:20252744-20252766 TCAGGTGTTGAGAAGGAGCAAGG - Intergenic
1052518613 9:29514378-29514400 ACCAGTCTTGAGAAGGAGTCAGG - Intergenic
1054809499 9:69423804-69423826 TCTAGTTGTGGGCAGGAGGAGGG - Intergenic
1055040805 9:71869485-71869507 TCCTGTCTTGAGAAGCATGAAGG + Intronic
1055490288 9:76797890-76797912 TCTGCTCTTAGGAAGGAGGAGGG - Intronic
1055927257 9:81523462-81523484 TCCAGTTTTCAAAAGGAGGAAGG - Intergenic
1056158177 9:83860708-83860730 TCCAGTGTGGAGCAGGAGGATGG - Intronic
1056352371 9:85763349-85763371 TCCAGTGTGGAGCAGGAGGATGG + Intergenic
1057999731 9:99852742-99852764 TCTAAGACTGAGAAGGAGGAAGG + Intronic
1058374670 9:104308683-104308705 TTTAGTCTTGGGAAGGTGTATGG - Intergenic
1058764930 9:108173145-108173167 TCTAGTTTTGTGAAGAATGATGG + Intergenic
1059024834 9:110615374-110615396 TAAAGTCTTGGAAAGGAGGAGGG - Intergenic
1059190591 9:112322168-112322190 TCCAGTCTCTAGCAGGAGGAGGG + Intronic
1059873472 9:118604265-118604287 TCTAGTTGTGAGGAGGAGGTGGG + Intergenic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1062121481 9:134836246-134836268 TCCAGTCTTGGGAAGGTGAAGGG + Intronic
1203665780 Un_KI270754v1:19893-19915 ACTAGTCTTTCAAAGGAGGAGGG - Intergenic
1203666926 Un_KI270754v1:25531-25553 ACTAGTCTTTCAAAGGAGGAGGG - Intergenic
1203668074 Un_KI270754v1:31170-31192 ACTAGTCTTTCAAAGGAGGAGGG - Intergenic
1187058156 X:15760395-15760417 TCTAGTTTAGTAAAGGAGGAGGG + Intronic
1188716490 X:33465060-33465082 TCTAGTCTTGAGTGGAAGGAAGG + Intergenic
1190428630 X:50356414-50356436 TCTAGTCCTGTGAAGAATGATGG + Intergenic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1190879401 X:54482350-54482372 TCTAGTCCAGAGAAGCAGGGAGG - Intronic
1190885643 X:54529382-54529404 TTTAGGCTTGAGGAAGAGGAGGG + Intergenic
1194459021 X:94142873-94142895 TCTAGTCTTGAGTCGGAGATGGG + Intergenic
1196131304 X:112159877-112159899 TATAGGCATGAGAAAGAGGAGGG - Intergenic
1196137424 X:112225220-112225242 TTTAGTCTTGAAAAAGAGGTAGG - Intergenic
1196619979 X:117810403-117810425 TCTAGTTTTGTGAAGAATGATGG - Intergenic
1197054621 X:122101966-122101988 TCTAGTCCTGTGAAGAATGATGG - Intergenic
1197167691 X:123396023-123396045 TCTATTCTTGCCAGGGAGGAAGG - Intronic
1198913216 X:141637034-141637056 TGTAGTCATGTGAATGAGGATGG + Intronic
1200447583 Y:3283973-3283995 TCTAGTTTTGTGAAGAATGATGG + Intergenic
1202113412 Y:21447910-21447932 TTAAGTCTTGAGAAGGAGTTTGG - Intergenic