ID: 1145780152

View in Genome Browser
Species Human (GRCh38)
Location 17:27557422-27557444
Sequence GCTGCTGGTGCCCACTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 315}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145780147_1145780152 17 Left 1145780147 17:27557382-27557404 CCTCTTTCCAGGCAAGAATTAGA 0: 1
1: 1
2: 2
3: 18
4: 211
Right 1145780152 17:27557422-27557444 GCTGCTGGTGCCCACTGTGGTGG 0: 1
1: 0
2: 3
3: 45
4: 315
1145780146_1145780152 18 Left 1145780146 17:27557381-27557403 CCCTCTTTCCAGGCAAGAATTAG 0: 1
1: 1
2: 2
3: 14
4: 181
Right 1145780152 17:27557422-27557444 GCTGCTGGTGCCCACTGTGGTGG 0: 1
1: 0
2: 3
3: 45
4: 315
1145780148_1145780152 10 Left 1145780148 17:27557389-27557411 CCAGGCAAGAATTAGACATAGCA 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1145780152 17:27557422-27557444 GCTGCTGGTGCCCACTGTGGTGG 0: 1
1: 0
2: 3
3: 45
4: 315
1145780145_1145780152 19 Left 1145780145 17:27557380-27557402 CCCCTCTTTCCAGGCAAGAATTA 0: 1
1: 0
2: 1
3: 15
4: 182
Right 1145780152 17:27557422-27557444 GCTGCTGGTGCCCACTGTGGTGG 0: 1
1: 0
2: 3
3: 45
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145780152 Original CRISPR GCTGCTGGTGCCCACTGTGG TGG Intronic
900311008 1:2033109-2033131 GCTGCAGGTGCCCCCTGTTGCGG - Intergenic
900380995 1:2383860-2383882 GCTGCTGGTCCACAGTGTGGGGG - Intronic
901266489 1:7914343-7914365 CCTCCTGGTGCTCACGGTGGCGG - Intergenic
901643942 1:10706712-10706734 GCAGAGGGTGCCCACTGGGGCGG + Intronic
902294416 1:15456765-15456787 GCTGCTGCTGTCCACTTTGGTGG + Exonic
902297244 1:15476137-15476159 CCTGCTGCTGTCCACTTTGGTGG + Exonic
902747782 1:18484705-18484727 GCTGCTGGTGCCCAGGCTGTGGG + Exonic
902786629 1:18736892-18736914 GCTGCTGGTGGCCACTGTGCTGG + Intronic
904432884 1:30476596-30476618 ACTCCAGCTGCCCACTGTGGTGG - Intergenic
904567556 1:31436793-31436815 GCTGCAGGTCCCCAGTGTGGAGG + Intergenic
904675572 1:32197320-32197342 GCTGCTGGATCCCAGTGTGGTGG + Exonic
904758526 1:32783775-32783797 GCTGCTGCTGTCCAATATGGTGG + Intronic
905857409 1:41323097-41323119 GCCGCTGGTGGCCAGTGTGTGGG + Intergenic
906159875 1:43640185-43640207 GCTGCTAGTGCCCACTGGCAAGG + Intergenic
906371987 1:45261960-45261982 GCTGCAGGTGCCCTCTGGGCTGG - Intronic
907247365 1:53116689-53116711 GCGGCTGGACCCCACTGCGGGGG - Intronic
908206239 1:61852797-61852819 GCTGCTACTGCCTACTGAGGTGG - Intronic
908510367 1:64846177-64846199 GCTGCTGCTGCACACTGAGATGG - Intronic
908605996 1:65797571-65797593 GCTGCTGGTGCCACCTGAAGGGG + Intronic
910114477 1:83716918-83716940 TGGGCTGGTCCCCACTGTGGTGG - Intergenic
910146474 1:84086122-84086144 GTTGGTGGTGCCCACTGTGCTGG + Intronic
913987131 1:143575337-143575359 CGTGCAGGAGCCCACTGTGGGGG - Intergenic
914932963 1:151950781-151950803 GCTGCTGCTGCCCATTTGGGAGG + Intergenic
915195745 1:154188346-154188368 CCTTCTTGTGCCCAGTGTGGTGG - Intronic
915473658 1:156139935-156139957 CCTGCTGGCACCCACCGTGGAGG + Exonic
915913597 1:159928807-159928829 TGTGATGGGGCCCACTGTGGCGG - Exonic
917920837 1:179748298-179748320 GCTGCTGTTGCCCACAGTGGTGG + Intronic
921974127 1:221182709-221182731 GAAGCTGGAGCCCATTGTGGTGG + Intergenic
922223666 1:223627406-223627428 GCAGCTGGGGCCAACTCTGGAGG - Intronic
922380210 1:225015810-225015832 GCTGTTGCTTCCCACTCTGGTGG - Intronic
922481148 1:225940821-225940843 GCCGGTTGTGCCCACTCTGGAGG - Intronic
922897057 1:229108689-229108711 GGTGCTGGTGTGCACTGTGCAGG - Intergenic
923069631 1:230550582-230550604 GCTGGTGCTGCTCAGTGTGGAGG - Intergenic
923087096 1:230710223-230710245 GCTGCTGCTGTCCACGGTGGTGG - Exonic
924920731 1:248626683-248626705 GCTGCTGGTGCCTGGTTTGGGGG - Exonic
1063531161 10:6832654-6832676 TCATCTGGTGCCCAATGTGGGGG - Intergenic
1063759528 10:9057356-9057378 GCTGCTGCTGCTCACTGTTTGGG + Intergenic
1064103912 10:12485367-12485389 GCTCCTCGTGCCCCCTGTCGTGG + Intronic
1066441959 10:35448076-35448098 GCCGCTGGTTCCCACAGTGAAGG - Intronic
1067827459 10:49588172-49588194 GCTGCTGCTTCCCAGTCTGGTGG + Intergenic
1067944066 10:50679486-50679508 GCTCCAGGCGCCCTCTGTGGAGG + Intergenic
1068523848 10:58106104-58106126 GCAGGTGGTGCCCACTCAGGGGG - Intergenic
1068657658 10:59591652-59591674 CTTGTGGGTGCCCACTGTGGTGG - Intergenic
1069907761 10:71741876-71741898 CCACCTGGTGGCCACTGTGGAGG + Intronic
1070825920 10:79390678-79390700 GCAGCTGGGGCTGACTGTGGTGG + Intronic
1071665281 10:87549450-87549472 GTTGCTGGTGGCTACTGTGTTGG - Intronic
1071925958 10:90409229-90409251 GCTGTTGCTTCCCATTGTGGTGG - Intergenic
1072619177 10:97068385-97068407 GATGTTGGTGCCCACTCTGTGGG - Intronic
1072690570 10:97570217-97570239 GCTGCTGGAGCACACGGAGGAGG + Exonic
1073202418 10:101746445-101746467 ATTACAGGTGCCCACTGTGGAGG - Intergenic
1073499894 10:103927137-103927159 GCAGCTGGTGACCACTAGGGAGG - Intergenic
1074871907 10:117583560-117583582 GCTGTTGTTGCCCAGGGTGGTGG + Intergenic
1074889412 10:117722675-117722697 GCTGCAGGAGCCACCTGTGGGGG + Intergenic
1075123479 10:119681350-119681372 GCTTCTGCTGCCCTCTGTTGTGG - Intergenic
1075223002 10:120600814-120600836 TGTGCTGGTGCCCACAGAGGTGG + Intergenic
1076133579 10:128029782-128029804 CCTGGTGATGCCCACTGTGGGGG - Intronic
1076200891 10:128557114-128557136 GCTGGAGGTGCCGACTGGGGAGG + Intergenic
1076445808 10:130513054-130513076 CCTGCTGGTGCCCAGGGTTGAGG + Intergenic
1077167142 11:1148814-1148836 GCACCTGGGGCGCACTGTGGGGG + Intergenic
1077662490 11:4082330-4082352 GCTGCTGGTGGCCAAGGAGGGGG + Exonic
1077713574 11:4559260-4559282 GCTGCTGCTTCCCACTCTGTGGG - Intergenic
1077822925 11:5768148-5768170 GCTGGTGGTACCCACTATGGTGG - Intronic
1083074266 11:60020337-60020359 GCTGCAGGAGCCCACGGTGGGGG + Intergenic
1083193275 11:61067998-61068020 GTGGCTGGAGCCCAGTGTGGAGG + Intergenic
1083762485 11:64826297-64826319 CCTGCTGGTGCCCACTGGTGGGG + Intronic
1084194403 11:67516301-67516323 GCAGCAGGTGCCCCCTGTAGCGG + Intergenic
1084302768 11:68262113-68262135 GGTGGTGGTCACCACTGTGGGGG + Exonic
1084517487 11:69644608-69644630 GCTTCTGCTGCCCACGGTGGCGG - Intronic
1086850330 11:91800220-91800242 GATGCTGGTGCCTGCAGTGGAGG + Intergenic
1087154048 11:94883937-94883959 TCTGCTGGGCCCCACTGGGGTGG + Intergenic
1087806273 11:102558747-102558769 GATGCTGGTGCCCAAGGTGGAGG + Intergenic
1088736979 11:112735880-112735902 GCTGCTGCTGGTCATTGTGGTGG + Intergenic
1089505407 11:118958802-118958824 GGGGCTGGTGCCCCATGTGGAGG + Intergenic
1089538155 11:119173353-119173375 GATGCTGGGGCCCACAATGGTGG - Intronic
1090606197 11:128425067-128425089 ACTGCTGGGACACACTGTGGTGG + Intergenic
1090876368 11:130792058-130792080 GCTGTGGGTGTCCACAGTGGTGG + Intergenic
1092161186 12:6316323-6316345 GGTGCTGGGGCCCACCCTGGAGG + Exonic
1094498710 12:31005349-31005371 GCTGTCCGTGGCCACTGTGGGGG - Intergenic
1096094493 12:48925365-48925387 GCTGCTGCTGCTCAGTGCGGCGG - Exonic
1096243807 12:49973494-49973516 GCTGGTGGGGGCCACGGTGGGGG + Exonic
1097098721 12:56571004-56571026 GTTGCTGGTGACCACTGTTTAGG + Intronic
1100885681 12:99067235-99067257 ACTGCTGGTGCCCAATGTTGAGG - Intronic
1101603885 12:106233304-106233326 GCTGCAGGAGCCCACGGAGGTGG - Intergenic
1102113059 12:110379931-110379953 CCTGATTGTGCCCACTCTGGAGG + Intronic
1102487549 12:113268495-113268517 ACTGCTGGTATCCACTGAGGAGG - Intronic
1104014428 12:124952693-124952715 CCTGCTGGTGGCCTCTGGGGAGG - Intronic
1104227557 12:126850568-126850590 GCTGATGGTTCCCACTGTTTTGG - Intergenic
1110367944 13:74708690-74708712 GCTGATGGTGCCCACATAGGTGG - Intergenic
1110760518 13:79225540-79225562 AATGCTGGTGCCCACTGAGGGGG - Intergenic
1111141569 13:84126837-84126859 CATGCAGGTGCCCACAGTGGAGG - Intergenic
1112104502 13:96226007-96226029 GCTTCTGTTGCCCTCAGTGGTGG + Intronic
1112333734 13:98497231-98497253 GCTTCTGGAGCCCTCAGTGGAGG - Intronic
1112462017 13:99611065-99611087 GCTGCTGGTTTTCACTGTGATGG + Intronic
1114391577 14:22314637-22314659 GCTGCTGGTTCCTCCTGTAGGGG - Intergenic
1114500621 14:23165693-23165715 GATGCTGGTGGCCACAGTGATGG - Intronic
1115164856 14:30436882-30436904 GATGCTGGTGGCCTCTATGGAGG - Intergenic
1115421315 14:33198816-33198838 CACGCTGGAGCCCACTGTGGGGG + Intronic
1115665040 14:35535743-35535765 GCTGCTCCTGCCCGCTCTGGCGG + Exonic
1116045164 14:39734252-39734274 GCTTGTTGTGGCCACTGTGGGGG + Intergenic
1121220551 14:92281680-92281702 CCTGCAGGTCCCTACTGTGGTGG + Intergenic
1121379468 14:93450274-93450296 GCTGTTTGAGGCCACTGTGGAGG + Intronic
1122159017 14:99769349-99769371 CCTGCTGGTGCCCACGGTGAGGG - Intronic
1122689991 14:103527755-103527777 GCAGCTGGTGGCCAGCGTGGTGG + Intergenic
1123479794 15:20620397-20620419 CCAGCTGGTGCCCACTGCAGAGG + Intergenic
1123638213 15:22379967-22379989 CCAGCTGGTGCCCACTGCAGAGG - Intergenic
1125431282 15:39596196-39596218 GCAGCTGGTGCTCACTGAGATGG - Exonic
1126530947 15:49710731-49710753 GATGCTGGTGTCCACAGTGGTGG + Intergenic
1127453511 15:59138399-59138421 GGTGCTGCTGCCCCCTGTTGGGG - Intronic
1128300789 15:66565305-66565327 ACTGCTGGTGCCCAGGCTGGGGG - Exonic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130923601 15:88368906-88368928 GCCACTGGTGCCCTCTGTAGGGG + Intergenic
1131372854 15:91897737-91897759 GCTGCTGGAGCCCACGCTGCAGG - Intronic
1132081770 15:98872043-98872065 GATGCAGGTACCCACTGGGGTGG - Intronic
1132196565 15:99918305-99918327 CCTTCTGGTGCCCAGGGTGGGGG - Intergenic
1132230949 15:100183904-100183926 GCTGCTGGTGATATCTGTGGGGG + Intronic
1132863652 16:2083429-2083451 GCTGCTGGTGGACACTAGGGTGG + Intronic
1132892363 16:2210566-2210588 GCTGGTGCTGGCCGCTGTGGGGG - Exonic
1133884068 16:9809778-9809800 GCTGCTGGGGCCGGGTGTGGTGG + Intronic
1134542077 16:15075767-15075789 GCTCCTGGTGCCCACCATGGCGG + Intronic
1134856143 16:17521076-17521098 GCTGCTGGTGTTCATGGTGGAGG + Intergenic
1136560875 16:31038560-31038582 GCTGCTGGATCTCACTGTGCCGG - Exonic
1136681072 16:31962698-31962720 GATGCTGGTGCCCATGGTTGAGG - Intergenic
1137062803 16:35807355-35807377 GCTTCAAGTGCCCAGTGTGGTGG + Intergenic
1137062886 16:35808499-35808521 GCTTCAAGTGCCCAATGTGGTGG - Intergenic
1137668928 16:50267971-50267993 GCTCCTGGTGCAGAGTGTGGGGG + Intronic
1137730806 16:50688193-50688215 GCTGCTGCTGCTGACAGTGGTGG - Intergenic
1137932804 16:52604619-52604641 GGGGCTGGTGTCCACTGTGCAGG + Intergenic
1138653922 16:58479354-58479376 CCTCCTGGTGCTCACTGAGGTGG + Intronic
1139653734 16:68375309-68375331 GCTGGTGGAGCCCAGGGTGGGGG - Intronic
1140202109 16:72903155-72903177 GAGGAGGGTGCCCACTGTGGAGG + Intronic
1141543033 16:84741532-84741554 GCTGGTGGTGCCCACTGCACAGG - Intronic
1141706523 16:85668240-85668262 GCTCCTGCTGCCCATTGTGCTGG - Exonic
1141763546 16:86044426-86044448 CCTCCCGGTGCCCACTGTGCTGG + Intergenic
1141834959 16:86532379-86532401 GGTGCTGGTGCTCACCCTGGAGG + Exonic
1141887931 16:86905519-86905541 TCTGCTGGTGCTCACGCTGGTGG - Intergenic
1142214100 16:88822393-88822415 CCTGCTGCTGCCCACCCTGGTGG - Intronic
1142280305 16:89144520-89144542 ACTGCTGGAGCCCACCGTGGTGG + Intronic
1143285694 17:5787602-5787624 GCTGGTGGTACCCACCTTGGGGG + Intronic
1143794316 17:9324424-9324446 GCTCCTGGTGCGCAGTGTGATGG + Intronic
1144684258 17:17215816-17215838 GCTGCTGGTCACCGCTGTGCTGG + Intronic
1144937540 17:18912383-18912405 CATGCTGGAACCCACTGTGGTGG - Intronic
1144967531 17:19087448-19087470 CCTGCTGCTTTCCACTGTGGAGG + Intergenic
1144980388 17:19164617-19164639 CCTGCTGCTTTCCACTGTGGAGG - Intergenic
1144987834 17:19213615-19213637 CCTGCTGCTTTCCACTGTGGAGG + Intergenic
1145029205 17:19491822-19491844 GCTGCTGGATACCACTGTTGAGG - Intergenic
1145780152 17:27557422-27557444 GCTGCTGGTGCCCACTGTGGTGG + Intronic
1145901000 17:28490501-28490523 GCTGCTGGTGGCCATCGCGGTGG + Exonic
1146223729 17:31048587-31048609 GCTGGTGTCTCCCACTGTGGTGG + Intergenic
1147522720 17:41189963-41189985 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147526258 17:41226731-41226753 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147526793 17:41232563-41232585 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147527297 17:41238113-41238135 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147528421 17:41249797-41249819 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147528941 17:41255447-41255469 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147530430 17:41271387-41271409 GCTGCAGGTGGTCACAGTGGTGG - Intergenic
1147530842 17:41275759-41275781 GCTGCAGGTGGTCACAGTGGTGG - Exonic
1147995171 17:44356201-44356223 AATGCTGGTGCCCACGGTGAGGG + Exonic
1148049023 17:44760035-44760057 GGTGCTGGAGCCCACTGGTGGGG + Intronic
1149792163 17:59488842-59488864 GCTGCTGGTGACCACTGGCAGGG - Intergenic
1150301503 17:64050862-64050884 GCTGCTGGTCCCCAGTGAGCTGG + Intronic
1151156166 17:72124072-72124094 GCTGCTGCTGCTCGCTGTAGTGG - Exonic
1151540962 17:74764326-74764348 GCTGCAAGGGCCCACTGGGGAGG + Intronic
1151845541 17:76652005-76652027 GCTGCTGGAGTCCACGGAGGAGG + Intergenic
1152248599 17:79199530-79199552 GCTGCCAGTGACCTCTGTGGTGG + Intronic
1152471367 17:80491674-80491696 GCTGCTGGGGCCCAGTGAGTGGG - Intergenic
1152645676 17:81467561-81467583 GCTGCTGGGCCCCACTGTTCTGG - Intergenic
1153987905 18:10369115-10369137 GCTGGTGGTGCCCATTGGGGTGG + Intergenic
1155169919 18:23259827-23259849 GCTGAAGCTGCCCTCTGTGGAGG - Exonic
1155183387 18:23367421-23367443 GCTGCTAAAGCCCACTGTGGGGG - Intronic
1155366875 18:25057768-25057790 TCTGCTGGCCCCCACTGTGTCGG - Intergenic
1158554121 18:58461059-58461081 GCTGCTGGTGTCACCTGTGTAGG + Intergenic
1160038471 18:75322200-75322222 GGTCCTGGTGGCCACTGTGGGGG + Intergenic
1160409986 18:78668610-78668632 GATGCTGGGGCCCACTGGGGAGG + Intergenic
1160973340 19:1780149-1780171 GGTGCTGGTGCCTGCTGTTGGGG - Exonic
1161014895 19:1978663-1978685 GCTGCTGGGGCCCAGCCTGGAGG + Exonic
1162199783 19:9011671-9011693 CCTGCAGGTGCCCAGTGTGAAGG + Intergenic
1162464512 19:10831894-10831916 GCTGCTGGTGGCTGCTGTGTGGG + Exonic
1162473402 19:10885849-10885871 GCTGCTGTGGCTCCCTGTGGGGG - Intronic
1162496452 19:11025778-11025800 GCAGCAGGACCCCACTGTGGGGG - Intronic
1163647303 19:18496680-18496702 GCTGCTGCTGTCCACTCAGGTGG + Intronic
1163752125 19:19084171-19084193 CCTGCCGGGGCACACTGTGGTGG - Intronic
1163871338 19:19823781-19823803 GCTGTTGCTTCCCACTCTGGTGG + Intergenic
1164455574 19:28403978-28404000 GCAGCTGGAGGCCAGTGTGGTGG - Intergenic
1164772359 19:30819385-30819407 GTTGCTGGTGACCAGTGAGGTGG + Intergenic
1165438841 19:35812385-35812407 GCTGGCAGTGCCCACTGAGGAGG - Exonic
1166497282 19:43313200-43313222 GTTGCTTCTGCCCACTGTGGGGG + Intergenic
1166641505 19:44498545-44498567 CCTGATGGTGCCCAGTTTGGTGG - Intronic
1166644453 19:44520600-44520622 GCTGCAGGTGCTCACTGGGCAGG + Exonic
1167062355 19:47157562-47157584 TCTGATGGTGCCCACTGGGGTGG + Intronic
1167090674 19:47341555-47341577 GGGGCTGGTGCTCACTGTGGCGG + Exonic
1167389255 19:49183018-49183040 GCTGGTGGTGGCCAGTGTTGGGG + Intronic
1167577727 19:50325772-50325794 GCTGCGGCTGCGCACTGCGGCGG - Intronic
1168374824 19:55867887-55867909 GTTGGGGGTGCCTACTGTGGAGG + Intronic
1168630113 19:57949870-57949892 GCTGCTGCTTCCCATCGTGGGGG + Intergenic
924962684 2:47558-47580 GGTGTTCGTGCCCACTTTGGGGG - Intergenic
926268488 2:11346209-11346231 TCTCCTGGTGGCCTCTGTGGAGG - Intronic
926308766 2:11659458-11659480 GGTGCTGGTGCCTCCTGAGGAGG + Intronic
927487178 2:23496537-23496559 GCTGCTGCTGCACACTGGCGGGG - Intronic
927682605 2:25149831-25149853 GGTGCTGGATCCCACTGCGGAGG - Intronic
927693519 2:25224531-25224553 GCTGGAGCTGCCCACTGAGGCGG + Intergenic
929898009 2:45978285-45978307 GCTTCTGGTTCCCACTGGGCTGG + Intronic
930111352 2:47681499-47681521 GCTGCTGGTACAGATTGTGGTGG - Intergenic
933650500 2:84846526-84846548 CCTGCTGGTGAGCACAGTGGGGG - Intronic
935691143 2:105733418-105733440 GCTGCTGGTGACCCCTAGGGAGG + Intergenic
936471798 2:112805448-112805470 AATGCGGGTGTCCACTGTGGAGG + Intergenic
936514251 2:113171931-113171953 GCGGCTGGGGCCCAGAGTGGAGG + Intronic
937475094 2:122208312-122208334 GGTGCTGCTGCCCACTGGGTTGG + Intergenic
938092373 2:128441956-128441978 GCTGCTGGTGGGCACTGACGAGG + Intergenic
938341841 2:130541148-130541170 GCTGCCCGTGCCCAGCGTGGGGG + Intronic
938347989 2:130579563-130579585 GCTGCCCGTGCCCAGCGTGGGGG - Intronic
939084803 2:137707147-137707169 GATGCTGGTGCCCACAGCAGAGG - Intergenic
939992884 2:148892131-148892153 GATGCTGGAGCCCACTATGCTGG - Intronic
942319812 2:174726361-174726383 GCTGCTGTTGTCCTGTGTGGTGG + Intergenic
944252449 2:197591632-197591654 GGTGCAGGAGCCCACGGTGGTGG + Intronic
946417761 2:219549143-219549165 CCGGCTGATGACCACTGTGGTGG - Exonic
947621946 2:231596428-231596450 GCAGCTGGGGCCCACTGCAGAGG + Intergenic
948614827 2:239191661-239191683 GCTCCTGGTGCCCAGGGTGAGGG + Intronic
948661298 2:239508144-239508166 GCTGCTGCAGCGCCCTGTGGCGG + Intergenic
1169531160 20:6486576-6486598 GCTCCAGGTGCCCTCTGGGGTGG + Intergenic
1171248428 20:23631732-23631754 GTTGCTGGTGACCATTGGGGTGG - Intronic
1171980022 20:31621272-31621294 ACTGCTGGTGCCGGGTGTGGTGG + Intergenic
1172987158 20:39000857-39000879 GCAGCTGGTGCCCACTGCAGAGG - Intronic
1174057593 20:47809450-47809472 GCTGCTGGTCCCAGCTGTGCTGG + Intergenic
1174400971 20:50275770-50275792 GCTGTTGGTGCCCACCTGGGAGG + Intergenic
1174734709 20:52954987-52955009 GCTGCTGGTGATCATTGTGGGGG + Intergenic
1175423741 20:58851745-58851767 ACTGCTAGAGCCCACTGAGGCGG - Intronic
1175504089 20:59469767-59469789 GCCGCTGGTGGTCGCTGTGGAGG + Intergenic
1175890986 20:62315818-62315840 GCCCCAGCTGCCCACTGTGGGGG + Intronic
1177941444 21:27416805-27416827 GTTGCTGGGGTCCACTGGGGTGG + Intergenic
1179541243 21:42084367-42084389 GCTGCCTGTGCACACGGTGGGGG - Intronic
1179890181 21:44331299-44331321 GCTGCTGGTGCCTGTGGTGGGGG - Intronic
1179894101 21:44351742-44351764 GCATCTGATGCCCGCTGTGGGGG - Intronic
1179963554 21:44786137-44786159 GCTGCAGGGGCCCAGAGTGGCGG - Intronic
1179989340 21:44938999-44939021 AGTGCTGGTGCCCAGTGTTGGGG + Intronic
1180131883 21:45832078-45832100 GCTGCTGGTGCCCATTTTTATGG + Intronic
1180199326 21:46215254-46215276 GCCGCAGGTGGGCACTGTGGTGG + Exonic
1180783544 22:18534834-18534856 GCTGCTGGTCACTACTGTGGTGG - Intergenic
1181083342 22:20428040-20428062 GCTTCTGGGGCCCCCTGTTGTGG - Intronic
1181127111 22:20708885-20708907 GCTGCTGGTCACTACTGTGGTGG - Intronic
1181240446 22:21474186-21474208 GCTGCTGGTCACTACTGTGGTGG - Intergenic
1183651689 22:39158769-39158791 GAATCTGTTGCCCACTGTGGTGG + Intergenic
1184490259 22:44804229-44804251 GCTGCTGGTGTCTGCTGTGCTGG + Intronic
1184693741 22:46128812-46128834 GCTGCAGGAGCTCACTGGGGAGG - Intergenic
1184702633 22:46186806-46186828 GCTTCAGGTATCCACTGTGGGGG - Intronic
949570317 3:5285852-5285874 GCTGCTGGGGTCCTCTTTGGAGG + Intergenic
950304601 3:11908232-11908254 GCTGCTGGTGCTCAGGGTGGAGG - Intergenic
950706433 3:14785351-14785373 GCGGGTGGTGTCCACTGTAGAGG - Intergenic
951727289 3:25774457-25774479 GCTTGTTGTGGCCACTGTGGCGG + Intronic
953035351 3:39206229-39206251 GTTGCTGGTGCCCTCTGGGTGGG - Intergenic
954219353 3:49143569-49143591 GCTGGCAGTGCCCACTGTGGGGG + Intergenic
954314302 3:49792866-49792888 GGTGCTGGTGGCCACTGTGCTGG + Exonic
954861068 3:53690754-53690776 GCTAGGGGTTCCCACTGTGGAGG - Intronic
955624260 3:60899979-60900001 GCTGCTGGGGCCCAATGAGTGGG - Intronic
956604297 3:71056668-71056690 GAAGCTGGAGCCCACTTTGGAGG - Intronic
957048961 3:75396897-75396919 GCTGCTGGTGCCTGATGTGCAGG + Intergenic
959472087 3:106764427-106764449 GCTTCTGCTTCCCACAGTGGTGG - Intergenic
960996388 3:123343285-123343307 GCTGGTGGTCCCCACTGATGAGG + Intronic
961166432 3:124766861-124766883 GAGGCTGGTGCCCACCGTGGTGG + Intronic
961448250 3:126991125-126991147 GCAGCTGGGGGCCAGTGTGGAGG - Intronic
964446201 3:156761271-156761293 TCTCCTGGGGCCCACTGTGGTGG - Intergenic
965523949 3:169697190-169697212 ACTGCTGGAGCCCACTTTGTTGG + Intergenic
968374549 4:28052-28074 GGTGCTGCTGTCCTCTGTGGAGG - Intergenic
968543235 4:1178869-1178891 GCAGCTGGTCCCCCCTGTGCAGG + Intronic
968874025 4:3255791-3255813 GCTGCTGGAGGCCATGGTGGAGG + Exonic
968984496 4:3867697-3867719 GCAGCAGCTGCCCACAGTGGGGG - Intergenic
969300828 4:6295972-6295994 TCTGCTGGGGCCCCCTGTGCTGG - Intronic
969390509 4:6888815-6888837 ACTGCTGGTGCCCACTGTGAGGG - Intergenic
969392788 4:6902183-6902205 GCTGCTGTTCCCTCCTGTGGGGG + Intergenic
969608868 4:8216160-8216182 GCTGCTCTTGCCCAGTGAGGAGG + Exonic
970205931 4:13655345-13655367 GCTGCAGGTGACCTCTGGGGTGG + Intergenic
971006717 4:22382556-22382578 GCTGCTGGTGCCCATTTTTATGG - Intronic
972630188 4:40835753-40835775 ACTGCTGGGGGCCACTGCGGTGG + Intronic
974717090 4:65680860-65680882 AGTGCTGATGACCACTGTGGGGG + Intergenic
978563965 4:110062419-110062441 ACTGCTGGGGAGCACTGTGGGGG + Intronic
984706678 4:182852268-182852290 GCTGCTGGTGCCCATTTTTAAGG - Intergenic
985214914 4:187640924-187640946 GCTGCAGATGTCCACAGTGGTGG - Intergenic
985964565 5:3330103-3330125 GCTGCTGGTGCTGAGGGTGGAGG - Intergenic
986714121 5:10510363-10510385 GCTTCTGGAACCCACTGAGGGGG + Intronic
986772858 5:10989238-10989260 GCTGCAGGTGCCCACAGGGTGGG - Intronic
988357492 5:30197972-30197994 GTTGCTGCTGCTCACTGGGGTGG - Intergenic
990457872 5:56005463-56005485 CCTGCAGGTGCCTAATGTGGGGG - Intergenic
991604194 5:68383862-68383884 GCTCCTGGTGCCCACAGTTCAGG + Intergenic
994210739 5:97085307-97085329 GCTGCTGGAGCACACCGCGGGGG + Intergenic
994676253 5:102826542-102826564 GCTGCTGGTGCCCTATCTAGAGG + Intronic
994692540 5:103035561-103035583 GCTGCTTCTGCTCACTGTGGAGG + Intergenic
996664497 5:126043114-126043136 GCTGCAGGTGCTCTCTGAGGAGG - Intergenic
997349929 5:133223453-133223475 CCTGCTGCTGCCCACTGAGCTGG + Intronic
997370717 5:133357934-133357956 AGTGCTGGTGCCCACTCAGGAGG + Intronic
997727277 5:136132598-136132620 GCTTCTAGCGCCTACTGTGGTGG + Intergenic
998053347 5:139054783-139054805 GTTGCTCTTGCCCCCTGTGGTGG - Intronic
998093077 5:139382198-139382220 GCTACTGCTGACCACTCTGGGGG + Intronic
1000514048 5:162218581-162218603 GTCGCTGGTGGCCACTGTGTTGG + Intergenic
1001246372 5:170108238-170108260 GCTGGTGGTGCCCCCTGGTGAGG - Exonic
1001925100 5:175630526-175630548 GAGGCTGGTGCCCACTGGGAAGG - Intergenic
1002633654 5:180596652-180596674 GCTGCTGCTGGCCGCTGTGGTGG - Intergenic
1002755522 6:156107-156129 GGTGCTGCTGTCCTCTGTGGAGG - Intergenic
1003234127 6:4281159-4281181 GCAGCTGGTGCCTGCTCTGGGGG + Intergenic
1003398210 6:5771066-5771088 GCTGCTGGTTTCCACTGGGGTGG - Intronic
1003979986 6:11380371-11380393 GCTCCAGTTGCCCACAGTGGCGG - Intronic
1004217354 6:13715137-13715159 GCCACTGGTGCCCACAGTAGAGG + Intergenic
1012245898 6:96925084-96925106 GCTGCTGGTGCGCCAAGTGGGGG + Intronic
1014577787 6:123094766-123094788 GCTGCTGGGGCCCAGAATGGAGG - Intergenic
1015381257 6:132571951-132571973 GCTTCTGCTTCCCACTTTGGGGG - Intergenic
1015539369 6:134298562-134298584 GCTGCTGCTGCCCACTCAGGAGG + Intronic
1016201660 6:141417553-141417575 GATGCTGGTTCCCTCCGTGGTGG + Intergenic
1017868724 6:158467954-158467976 GCAGCTGGTGCCCCCTGGAGAGG - Intronic
1018317120 6:162568416-162568438 GCTGCTGCTGCCCATAGAGGTGG - Intronic
1018634202 6:165846561-165846583 ACTGATGGTGCACACTGTGATGG - Intronic
1019125495 6:169837929-169837951 GCTGCTGATGGCTGCTGTGGCGG - Intergenic
1019498898 7:1354711-1354733 TCTGCTGATGCCCACTGAGCCGG + Intergenic
1019538341 7:1540287-1540309 GCTGGTGGTGGCCACCTTGGAGG - Exonic
1020092360 7:5348842-5348864 GCCGCTGTGGCCCACTGGGGCGG - Intronic
1020332368 7:7032663-7032685 GCTTGTTGTGACCACTGTGGGGG + Intergenic
1022788648 7:33664512-33664534 GCTGCTGGTTCACACTTTGTAGG - Intergenic
1024785481 7:52902501-52902523 GCTGCTGGAGAACACTGAGGAGG - Intergenic
1026776018 7:73231597-73231619 CCTGCTGGCACCCACTCTGGGGG - Intergenic
1027016875 7:74784968-74784990 CCTGCTGGCACCCACTCTGGGGG - Intronic
1027071152 7:75160968-75160990 CCTGCTGGCACCCACTCTGGGGG + Intergenic
1029527591 7:101104482-101104504 GCTCCTGGTGCCTCCTGTGGGGG + Intergenic
1032731421 7:134646916-134646938 GCTGCTGGTGGCCCCTTTGCAGG + Exonic
1033078110 7:138268302-138268324 CCTGCTGGTGCCATTTGTGGAGG - Intergenic
1033089466 7:138371743-138371765 CCTGCTGGTGCCATGTGTGGTGG - Intergenic
1034152564 7:148928484-148928506 GCTGCTGGTGCCTACCCTGTTGG - Intergenic
1035231817 7:157469976-157469998 GGCGCTGGGGGCCACTGTGGTGG - Intergenic
1035326791 7:158070865-158070887 GGTGGTGGTGCCCATGGTGGTGG + Intronic
1036444858 8:8812366-8812388 GCTGCTGGGTCCCAGGGTGGTGG + Intronic
1037181517 8:16012529-16012551 GCTGCTGGTGGGGACGGTGGTGG + Intergenic
1037755497 8:21707430-21707452 GGTGCTGGTGCCTGCTGAGGGGG + Intronic
1041144073 8:54853448-54853470 GCTCCTGGTGCCCAGTCTGGTGG - Intergenic
1042360915 8:67882222-67882244 CCTGCTGGGGCACACTCTGGGGG + Intergenic
1043694357 8:83201461-83201483 GGTGGTGGTTCCCACTGTGGTGG - Intergenic
1044675070 8:94720098-94720120 GCTGCTGGTGGCCGCGGTCGCGG + Intronic
1045560168 8:103254235-103254257 GTTTCTGGTGCCCCCTCTGGAGG - Intergenic
1047327902 8:123857692-123857714 GCTGCTGGTACCCACTTCAGAGG - Intronic
1048352824 8:133629799-133629821 GCAGCTGGAACCCACTCTGGGGG - Intergenic
1048602680 8:135934741-135934763 GTGCTTGGTGCCCACTGTGGGGG + Intergenic
1049228455 8:141469496-141469518 GCTGGTGGTGATGACTGTGGGGG + Intergenic
1049387531 8:142351145-142351167 ACTGCTCGTGGCCAGTGTGGCGG - Intronic
1049474603 8:142790845-142790867 GCTGGTGGTGCCCACAGGCGGGG + Intergenic
1049695289 8:143981278-143981300 GATGATGGTGGCCACGGTGGTGG + Intronic
1049758517 8:144321431-144321453 CCTGCTGGTGCCCACTCAGGGGG - Intronic
1053067603 9:35079489-35079511 GCAGCTGGAGCCCACAGAGGTGG + Exonic
1053138220 9:35665025-35665047 GGGGCTGGTGGCCACGGTGGGGG - Exonic
1053352900 9:37424969-37424991 GCTGCAGGTGCACACTGGGTGGG + Exonic
1053715727 9:40885335-40885357 GCTGCTGGTGCCTGATGTGCGGG + Intergenic
1054076822 9:60545403-60545425 GCTGCTGGTGCCTGATGTGCAGG - Intergenic
1057364053 9:94401877-94401899 GCTGCTGGTGCCCATTTTTATGG + Intronic
1057368303 9:94445047-94445069 TGTGCTGGTGGCCACAGTGGTGG + Exonic
1057421254 9:94914726-94914748 GCTGCTGATCTGCACTGTGGTGG - Intronic
1057572859 9:96217644-96217666 TCTGCAGGTCCCCACTCTGGTGG - Intergenic
1057659283 9:96986184-96986206 GCTGCTGGTGCCCATTTTTATGG - Intronic
1060069509 9:120533953-120533975 GCTGATGGTGACCAAAGTGGAGG - Intronic
1060105442 9:120870077-120870099 GCTGCTGGTGCCCACCAAGATGG + Intronic
1060872561 9:127054565-127054587 CCTGCTGCTGCCCACTGTCCTGG - Intronic
1060881720 9:127122466-127122488 TCTGCCGGAGCCCTCTGTGGAGG - Exonic
1061204797 9:129156686-129156708 GCTGCCTGTCCCCACTGTGGTGG + Intergenic
1203574670 Un_KI270744v1:166098-166120 GGTGCTGCTGTCCTCTGTGGAGG + Intergenic
1189826548 X:44924491-44924513 GCTAATGTTGCCCAGTGTGGAGG + Intronic
1190747329 X:53332353-53332375 GCTGCTCCCTCCCACTGTGGCGG + Intergenic
1193601004 X:83508527-83508549 GGGGCTGGTGGCCAGTGTGGAGG - Exonic
1195750273 X:108157232-108157254 GCCGCTGGTGCCGAGGGTGGAGG - Exonic
1197643463 X:128992675-128992697 GCTGCTGGTGCCAGTGGTGGTGG + Intergenic
1200152349 X:153957402-153957424 GCTGCTGATGCCCAGGATGGTGG + Exonic
1201580113 Y:15502414-15502436 GCAGCTGGTGCCTAATTTGGGGG - Intergenic