ID: 1145784873

View in Genome Browser
Species Human (GRCh38)
Location 17:27587300-27587322
Sequence GTCCTCCCACATCAAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145784873_1145784884 28 Left 1145784873 17:27587300-27587322 CCCTCTCCTTGATGTGGGAGGAC 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1145784884 17:27587351-27587373 GAGGTTGGTTATGTGGTACTTGG 0: 1
1: 0
2: 0
3: 9
4: 90
1145784873_1145784883 21 Left 1145784873 17:27587300-27587322 CCCTCTCCTTGATGTGGGAGGAC 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1145784883 17:27587344-27587366 TCTCATGGAGGTTGGTTATGTGG 0: 1
1: 0
2: 2
3: 18
4: 130
1145784873_1145784879 9 Left 1145784873 17:27587300-27587322 CCCTCTCCTTGATGTGGGAGGAC 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1145784879 17:27587332-27587354 CCAGCACACCCTTCTCATGGAGG 0: 1
1: 0
2: 0
3: 22
4: 189
1145784873_1145784880 13 Left 1145784873 17:27587300-27587322 CCCTCTCCTTGATGTGGGAGGAC 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1145784880 17:27587336-27587358 CACACCCTTCTCATGGAGGTTGG 0: 1
1: 1
2: 0
3: 16
4: 143
1145784873_1145784877 6 Left 1145784873 17:27587300-27587322 CCCTCTCCTTGATGTGGGAGGAC 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1145784877 17:27587329-27587351 CCTCCAGCACACCCTTCTCATGG 0: 1
1: 0
2: 0
3: 35
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145784873 Original CRISPR GTCCTCCCACATCAAGGAGA GGG (reversed) Intronic
900208230 1:1440558-1440580 GACCTCTCACAGCAAGAAGATGG - Exonic
900683596 1:3932652-3932674 CTCCTCCCACCTGGAGGAGAAGG - Intergenic
902520673 1:17013956-17013978 CTCCTCCCTCATTAAGGAGAAGG - Intergenic
904421316 1:30396288-30396310 TTCCTGTCACATCCAGGAGAAGG - Intergenic
905887107 1:41497262-41497284 GTCTTCACCCATCCAGGAGAAGG - Intergenic
908358616 1:63346131-63346153 TTCCTCCCACATGGACGAGATGG - Intergenic
910769988 1:90821556-90821578 GTCAACCCACATCAATGGGAAGG + Intergenic
915270061 1:154747376-154747398 CTCTTCCCACACCTAGGAGAGGG - Intronic
921113969 1:212069104-212069126 GGCCTCTAACATTAAGGAGAAGG - Intronic
922795364 1:228337083-228337105 GACCTCCCAGATCACTGAGATGG + Exonic
923566072 1:235076909-235076931 GTCCCCCCACATGCAGCAGATGG + Intergenic
923635676 1:235693477-235693499 CTTCTCACACCTCAAGGAGAAGG + Exonic
923980236 1:239313196-239313218 GTCCTCCCATTTGGAGGAGATGG - Intergenic
924173003 1:241360470-241360492 GGCCTGCCACATCCAGGAGGGGG - Intergenic
1062807795 10:437206-437228 ATCCTACCACATCCAGGAGGTGG - Intronic
1064259591 10:13774516-13774538 GTCCTCCCACATCCAGGGATCGG - Intronic
1064480303 10:15734013-15734035 GTACTTCCCCCTCAAGGAGATGG + Intergenic
1064778691 10:18808928-18808950 ATCCTCCCACATCAAGTAGCTGG - Intergenic
1071165431 10:82800844-82800866 GTCCACCCACATCAAGTCAAAGG - Intronic
1071197277 10:83175888-83175910 CTCCTCCCTCTTCAAGCAGAAGG + Intergenic
1072270149 10:93768491-93768513 GTCCTGGAACATCAAGGAGAAGG - Intronic
1072319546 10:94235115-94235137 GTCTTCCCACTCCATGGAGAAGG - Intronic
1075380501 10:122014836-122014858 CTCCTCCCTGATCAAAGAGAGGG + Intronic
1076677220 10:132153397-132153419 GGCCTCCCACAGCAAGGAGAAGG + Intronic
1076889352 10:133276329-133276351 GTCCTCCCCCAGGCAGGAGACGG + Intronic
1077951746 11:6966730-6966752 GTACACCCAAATCAAGCAGAAGG - Intronic
1081913929 11:46719071-46719093 GTCCTCCCAGATGGTGGAGATGG + Intergenic
1081952331 11:47055045-47055067 ATCCTCCCACCTCAAGTAGCTGG + Intronic
1084264777 11:67999262-67999284 GTACTCCCACTACAAGGAGCAGG - Exonic
1084313689 11:68331506-68331528 GTCTTCCCTCAACAGGGAGATGG - Intronic
1085272851 11:75280575-75280597 GTCGGCCCACATCTAAGAGATGG - Intronic
1087032738 11:93722217-93722239 ATCCTCCCACCTCAAGGTGCTGG - Intronic
1089842358 11:121429229-121429251 ATCCTCCCACCTCAAGTAGCTGG + Intergenic
1093177778 12:15932533-15932555 ATCCTCCCACCTCAAGTAGCTGG - Intronic
1094249787 12:28346850-28346872 GTCCCCCAACATCAAGGGAAAGG - Intronic
1100769811 12:97909487-97909509 GTTCTCCCAAATAAAGGACATGG + Intergenic
1101969760 12:109304764-109304786 GCCCTCCCACATCCCAGAGAAGG - Intronic
1123488636 15:20763017-20763039 GGCCCCCCACAGCAAGGAAAGGG + Intergenic
1123545132 15:21332090-21332112 GGCCCCCCACAGCAAGGAAAGGG + Intergenic
1126522107 15:49606579-49606601 GACCTCCCACATCAGAGTGAAGG + Intronic
1127167048 15:56254572-56254594 GTTGACCCACATCAAGCAGAAGG + Intronic
1127690892 15:61396286-61396308 GCCCTGCCCCATCAAGGAGCAGG - Intergenic
1128033336 15:64500901-64500923 GTCCTTCCAAGTCAAGCAGAAGG - Intronic
1131060669 15:89402285-89402307 GTCCTCCCAACTAAAGGAGATGG + Intergenic
1202953478 15_KI270727v1_random:59361-59383 GGCCCCCCACAGCAAGGAAAGGG + Intergenic
1132501522 16:286564-286586 GTGCACCCACTGCAAGGAGATGG + Exonic
1133843143 16:9428581-9428603 GTCCTCCCACCTGGAGGGGAGGG + Intergenic
1135959436 16:26983578-26983600 GTCCCCACACACCATGGAGAGGG + Intergenic
1136094465 16:27945114-27945136 ATCCTCCCACCTCCAAGAGACGG - Intronic
1139366851 16:66438864-66438886 GTCCTGACTTATCAAGGAGAAGG - Intronic
1140665043 16:77219682-77219704 TTCCTGCCACATCAAGCTGATGG + Intergenic
1143121251 17:4608497-4608519 CTCCTTCCACAACATGGAGATGG - Intergenic
1143763437 17:9121315-9121337 ACCCCCGCACATCAAGGAGAGGG - Intronic
1144638981 17:16927258-16927280 CTGATCCCACATCCAGGAGATGG - Intergenic
1145784873 17:27587300-27587322 GTCCTCCCACATCAAGGAGAGGG - Intronic
1147656980 17:42096653-42096675 GCCCTCCCACCTCCAGGAGTTGG - Intergenic
1151596173 17:75079168-75079190 GTCTTCCCACATCACGGGGCTGG + Intergenic
1152584031 17:81181241-81181263 CTCCTCCCAGATGAAGAAGATGG + Intergenic
1152723782 17:81935477-81935499 GACACCCCACAACAAGGAGACGG - Exonic
1153237049 18:2998146-2998168 GTCCTCCCAGAGCCAGGAAAGGG - Intronic
1153799089 18:8652808-8652830 GTCTTCCACCATCAAGGATAAGG - Intergenic
1157030020 18:43894494-43894516 ACCCTCCCACAACAAGGTGAGGG - Intergenic
1157211050 18:45742261-45742283 GTCCTTCAAGATCAAGGAGAAGG + Intronic
1159911737 18:74152254-74152276 GACCTCCCACACCAAGGTCAGGG - Intronic
1161178038 19:2859445-2859467 GACCTTCCACAGCAAGTAGAAGG + Exonic
1163174914 19:15557493-15557515 CTCCTCCCTCCTCAAGGACATGG + Intergenic
1165360223 19:35331911-35331933 GTCCTCCCGGATCCAGGGGAAGG + Intronic
1166765185 19:45248734-45248756 GTCCCCCCACATCTGGGAAATGG + Intronic
1167216985 19:48171276-48171298 GTGCTCCCACATCCAGGCCACGG - Intronic
1168262473 19:55203978-55204000 GACCTCCCAGCTCAGGGAGATGG + Exonic
1168262877 19:55206885-55206907 GACCTCCCAGCTCAGGGAGATGG + Exonic
925159129 2:1670949-1670971 CTCCCCCCACATCAGGCAGAAGG + Intronic
927696094 2:25240718-25240740 ATCCTCCCAGATCCAGGAGTGGG - Exonic
927812087 2:26185867-26185889 GTGCTCCCTCCTCAAGGAAAAGG - Intronic
928599332 2:32887778-32887800 ATACTCCCCCATCAAGGAGGTGG + Intergenic
931072035 2:58662646-58662668 ATCCTCCCACCTCAAGTAGCTGG - Intergenic
931264928 2:60652243-60652265 GCCCACCCAGTTCAAGGAGAAGG + Intergenic
934082769 2:88483503-88483525 GTCATCCCACACCAAGGAGCAGG - Intergenic
934477925 2:94605302-94605324 GTGCTCCCACATGAAGGAATAGG + Intergenic
936349597 2:111702756-111702778 GTCCTCTCACTTCCTGGAGATGG - Intergenic
943664965 2:190599882-190599904 GTCCTCCCAGGTGAGGGAGAGGG - Intergenic
943733290 2:191326045-191326067 GTCCTACCACATTAAGGGCATGG - Intronic
946306765 2:218860647-218860669 GTCCTCCCCAAGCAAGGAAAAGG + Intronic
948450786 2:238069908-238069930 CTCCTCTCACATGAAGGAAAAGG + Intronic
948648974 2:239427042-239427064 GTCCTTCCCCTCCAAGGAGAAGG - Intergenic
1169855604 20:10099222-10099244 AACCTCCCACCTCAAAGAGAAGG + Intergenic
1172804042 20:37598456-37598478 GCCCTCCCATTTCAAGGGGATGG + Intergenic
1173759623 20:45548093-45548115 TTCCTCAGACATCAAGGAGCTGG - Intergenic
1174170126 20:48612290-48612312 GTCCTCAGACATGAAGTAGATGG - Intergenic
1175628409 20:60509933-60509955 GTCTCCCCAGTTCAAGGAGATGG + Intergenic
1175677213 20:60957092-60957114 GTGCTCCAACCTCAAGGAGGGGG - Intergenic
1176209065 20:63908691-63908713 CTCCTCCCACTTCAAGCAGCTGG - Intronic
1176992155 21:15509880-15509902 TTCCTGTCACATCAAGAAGAGGG + Intergenic
1177397376 21:20554921-20554943 GTAATCCCACATCAAGGATTTGG + Intergenic
1177945865 21:27469098-27469120 GTCCCCCCAAATCAAGAAGGAGG - Intergenic
1178661178 21:34509225-34509247 GTCCTCCAACCACAAGGAAATGG - Intergenic
1180193933 21:46182521-46182543 GACCTCCCGCATCAGGGAGCTGG + Intronic
1182314883 22:29439088-29439110 GGCTTCCCACATCAAGGAACTGG + Exonic
1182695066 22:32192956-32192978 GGCTTCCCACATCAAGGAACTGG - Exonic
1182997546 22:34828064-34828086 GACCTCCAACATCAAGGTGCTGG + Intergenic
1184760163 22:46539197-46539219 GACCGCTCACATTAAGGAGACGG - Intergenic
1185017215 22:48351815-48351837 CTCCTCCTTCATCATGGAGACGG + Intergenic
949710566 3:6865561-6865583 TTCCTCCCAAAGCAAGTAGATGG + Intronic
950552443 3:13674975-13674997 GTCCTCCCACAGCAGCCAGAGGG - Intergenic
950933789 3:16818180-16818202 ATGCTCCCCCATCAAGGAGTTGG + Intronic
956528226 3:70187975-70187997 CTCCCACCACATTAAGGAGAAGG + Intergenic
960070165 3:113420689-113420711 GTCTTTCAACATCAAGGAAAAGG - Intronic
962921416 3:139953655-139953677 ATCCTCCCACCTGAGGGAGAGGG - Intronic
965087129 3:164113686-164113708 GGCCTCCCACTCCATGGAGAAGG + Intergenic
967975131 3:195030260-195030282 GTCCTCCAACATCCAGCAGAAGG + Intergenic
979984376 4:127295910-127295932 GTCCTTTCAAATCTAGGAGAAGG + Intergenic
980423227 4:132592232-132592254 GTCCCTCCTCATCATGGAGATGG + Intergenic
981444477 4:144819802-144819824 GTCCTCCCACAGCACGAACAAGG + Intergenic
981455363 4:144947209-144947231 GTTTTTCCACATCGAGGAGAAGG + Intergenic
982730294 4:158948717-158948739 ATCCTCCCACCTCAAGTAGCTGG + Intronic
983477936 4:168238572-168238594 ATCATCCCACAGTAAGGAGATGG - Intronic
983792482 4:171814150-171814172 GCCCTCCCACACTAAGGAGGTGG + Intronic
986063765 5:4216071-4216093 GTCCTCCTACATCCAGGACTAGG - Intergenic
989388727 5:40878728-40878750 GTCCTCCCTCCTCAAGGGGTGGG - Intergenic
990506794 5:56453373-56453395 GTCCTACAACCCCAAGGAGATGG - Intergenic
994246885 5:97488690-97488712 GTTGTCCCACATCCAGGAAAAGG + Intergenic
996771523 5:127091665-127091687 CTCCTCCCACCTCATGCAGAAGG + Intergenic
1003142117 6:3480435-3480457 GCCCTCACACAACAGGGAGAAGG + Intergenic
1004171870 6:13301518-13301540 GTGCTGCCACACCAGGGAGAAGG - Intronic
1005152255 6:22765633-22765655 TTACTGCCACATCCAGGAGAAGG + Intergenic
1006202842 6:32312103-32312125 GTACTCCCACATCAGGGACTAGG + Intronic
1007507100 6:42344069-42344091 GGCATCCCACCTGAAGGAGAAGG + Intronic
1007627696 6:43255536-43255558 CTCCCCCCACCTCCAGGAGATGG + Exonic
1011657976 6:89568708-89568730 GTCCTCACATAGCAGGGAGAAGG - Intronic
1013787598 6:113799021-113799043 GAAGTCCCACATCAAGGTGAGGG - Intergenic
1015455763 6:133424677-133424699 GGCCTCCCACTCCATGGAGAAGG - Intronic
1016959922 6:149663365-149663387 ATCCTCCCACCTCAAGTAGCTGG - Intronic
1017764803 6:157597795-157597817 CTCCTCCCACATCCAGGACATGG + Intronic
1018293441 6:162317214-162317236 ATCCTCTCACATCAAGGGCAGGG + Intronic
1018497363 6:164362804-164362826 AACTTCCTACATCAAGGAGAGGG + Intergenic
1019655914 7:2195562-2195584 GTCCTCCCACAGCAAGGGAGGGG - Intronic
1020085009 7:5305454-5305476 GTCCACCCCCATCTAGGTGAGGG + Exonic
1024829461 7:53432630-53432652 TTCCTCTCACATCAGGGAAATGG - Intergenic
1025008612 7:55376467-55376489 GTACTCCCTCATCAAAGAAAGGG + Intronic
1026763336 7:73143178-73143200 GTCCTCCTCCATCAAGAAGCAGG + Intergenic
1027039807 7:74952968-74952990 GTCCTCCTCCATCAAGAAGCAGG + Intergenic
1027083834 7:75249412-75249434 GTCCTCCTCCATCAAGAAGCAGG - Intergenic
1027333836 7:77127207-77127229 GGCCTCCCACAACATGGAGCAGG - Intronic
1027831766 7:83185743-83185765 GTCATTCTACCTCAAGGAGATGG + Intergenic
1028015702 7:85708938-85708960 ATCCTCACACATCAAGAACATGG - Intergenic
1028811243 7:95089316-95089338 GTCCTTTCACATGAAAGAGATGG - Intronic
1029781957 7:102744107-102744129 GGCCTCCCACAACATGGAGCAGG + Intergenic
1033635826 7:143210401-143210423 ATCCTCCCACCTCAAGTAGTTGG + Intergenic
1035052236 7:156005545-156005567 GGCCCCCCACAGCAGGGAGAAGG + Intergenic
1037683126 8:21115361-21115383 GTGCTCTCCCATGAAGGAGAGGG + Intergenic
1038428743 8:27482940-27482962 GTCCTTCCACATCAGGAGGAAGG + Intergenic
1038840421 8:31179890-31179912 ATCCTCCCACCTCAATTAGAAGG + Intergenic
1040594244 8:48822200-48822222 CTCCTCCCACAGCGGGGAGATGG + Intergenic
1046953695 8:120042159-120042181 GTCACCCCACCTCAAGTAGAAGG + Intronic
1047577255 8:126170791-126170813 GTTCTCACTCATCCAGGAGATGG - Intergenic
1048286424 8:133145344-133145366 GTCCTACAACAGCAAGGAGCTGG + Intergenic
1052852031 9:33384258-33384280 GTGCTCCCACATGAAGGAATAGG - Intergenic
1053117997 9:35522368-35522390 GGCCCCCCACAGTAAGGAGAGGG + Intronic
1053680134 9:40480806-40480828 GTGCTCCCACATGAAGGAATAGG - Intergenic
1053930127 9:43109116-43109138 GTGCTCCCACATGAAGGAATAGG - Intergenic
1054283578 9:63144129-63144151 GTGCTCCCACATGAAGGAATAGG + Intergenic
1054293214 9:63316316-63316338 GTGCTCCCACATGAAGGAATAGG - Intergenic
1054391242 9:64620809-64620831 GTGCTCCCACATGAAGGAATAGG - Intergenic
1054504487 9:65895518-65895540 GTGCTCCCACATGAAGGAATAGG + Intergenic
1055549782 9:77422210-77422232 GCCCTCCCACAACCAGGATATGG + Intergenic
1056771749 9:89482537-89482559 CTCCTCCAGCAGCAAGGAGAGGG + Intronic
1060157841 9:121332367-121332389 TGCCTCCCACACCAGGGAGAGGG - Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1185858976 X:3560188-3560210 GCCCACCCACATCATGGAGGGGG - Intergenic
1187303400 X:18073477-18073499 GTACTTCCACATGAAGGAGAGGG - Intergenic
1189549935 X:42082419-42082441 GTTCTCCCACCTGAGGGAGAGGG + Intergenic
1196082904 X:111651666-111651688 GTCCGCCCAAATCTAGAAGATGG + Intergenic
1196461433 X:115935805-115935827 CTCCTCTCTCATCAAGCAGAAGG + Intergenic
1198343041 X:135733234-135733256 GTCCTCAGACATTAAGGAAATGG + Intergenic
1198344948 X:135750061-135750083 GTCCTCAGACATTAAGGAAATGG - Intergenic
1199255325 X:145712923-145712945 ATCCTCCCAACTCTAGGAGATGG - Intergenic
1199418811 X:147619175-147619197 TTCCTCCCTCTTCAGGGAGATGG + Intergenic