ID: 1145785232

View in Genome Browser
Species Human (GRCh38)
Location 17:27589119-27589141
Sequence CCGGAAGCTCCCATCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145785225_1145785232 2 Left 1145785225 17:27589094-27589116 CCATGCAGTTTGGCGTCCCCTGC 0: 1
1: 0
2: 1
3: 6
4: 121
Right 1145785232 17:27589119-27589141 CCGGAAGCTCCCATCTTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 89
1145785223_1145785232 16 Left 1145785223 17:27589080-27589102 CCTTAAAAGGCACGCCATGCAGT 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1145785232 17:27589119-27589141 CCGGAAGCTCCCATCTTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 89
1145785221_1145785232 29 Left 1145785221 17:27589067-27589089 CCGGATCGCAACTCCTTAAAAGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1145785232 17:27589119-27589141 CCGGAAGCTCCCATCTTTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145785232 Original CRISPR CCGGAAGCTCCCATCTTTGT TGG Intronic
900799801 1:4730155-4730177 CCGGAAACTTCCATTCTTGTAGG - Intronic
902709763 1:18230750-18230772 CCTGGAGCCCCCATCTTGGTAGG - Intronic
905217490 1:36419421-36419443 CAGGAAGCTCTCAGCTTAGTGGG - Intronic
905674885 1:39818288-39818310 GAGGCAGCTCCCATCTGTGTGGG - Intergenic
909071229 1:70996187-70996209 CCAGACACTCACATCTTTGTTGG - Intronic
911164869 1:94715492-94715514 CAGGAAGTTTCCATCTTTTTAGG - Intergenic
913569980 1:120110274-120110296 CAGGAAGCACCCACCTTTGGGGG - Intergenic
914290788 1:146271239-146271261 CAGGAAGCACCCACCTTTGGGGG - Intergenic
914551832 1:148722022-148722044 CAGGAAGCACCCACCTTTGGGGG - Intergenic
919790801 1:201289634-201289656 CAGGGAGCTCCCAGCTTGGTTGG + Intronic
920009192 1:202855489-202855511 CAGGAAGCTCCCGTCTTAGCAGG + Intergenic
920609759 1:207424806-207424828 CCGGAAGGTCCCTTATCTGTGGG + Intergenic
1065243568 10:23734100-23734122 CTGGAACCTCCCAACTTAGTAGG + Intronic
1068961130 10:62867726-62867748 CCAGAAGATCCCAGCTATGTGGG - Intronic
1069069336 10:63977416-63977438 CCTGGAGCTACCAGCTTTGTTGG + Intergenic
1073131060 10:101189605-101189627 CCGGATGCTCCCTTCTTTTCTGG + Intergenic
1075527520 10:123199143-123199165 CCTGATCCTCCCATTTTTGTGGG + Intergenic
1076281909 10:129253575-129253597 CAGGAAGCTCACATTTTAGTGGG + Intergenic
1076688588 10:132209264-132209286 CCGGGAGCTCGCATCTCTGCGGG + Intronic
1081623774 11:44634739-44634761 CCTGAAGCTCCCACCTTGGGAGG - Intergenic
1084792788 11:71485303-71485325 CTGGGTGCTCCCATCTTTGAAGG + Intronic
1088542870 11:110931383-110931405 CCGGGAGGGCCCTTCTTTGTTGG - Intergenic
1090350561 11:126105224-126105246 ACGGAAGATCCCAGCTCTGTGGG - Intergenic
1100024455 12:90110873-90110895 CCGGAAGGTTCCATCATTATCGG - Intergenic
1101312417 12:103594433-103594455 CCGGATGCCGCCATATTTGTAGG + Exonic
1102328976 12:112013335-112013357 CAGGAGGCTCCCATCTGTCTAGG - Exonic
1110741472 13:79002323-79002345 CTGGAAGCCTCCAGCTTTGTAGG + Intergenic
1118355464 14:65009963-65009985 CAGGGAGCACCCATCTGTGTGGG - Intronic
1118821893 14:69351119-69351141 TGGGAAGCTGCCTTCTTTGTAGG - Intronic
1121831172 14:97053557-97053579 CTGGACACACCCATCTTTGTGGG - Intergenic
1130656950 15:85798446-85798468 CCGGGCGCTCCAATATTTGTAGG - Intergenic
1133071440 16:3249264-3249286 CCTGTAGCTCCCCTCTTTGCTGG + Intronic
1140453281 16:75088964-75088986 CCAGCAGCTCCCATCTCTGCCGG - Intronic
1141454981 16:84135397-84135419 GAGGAAGCTTCCATCTGTGTGGG - Intronic
1143475758 17:7203214-7203236 CTGCAACCTCCCATCCTTGTGGG + Exonic
1145785232 17:27589119-27589141 CCGGAAGCTCCCATCTTTGTTGG + Intronic
1147646826 17:42039360-42039382 CCAAAAACTCCCATCTTTGGGGG + Intronic
1149475965 17:56961006-56961028 TCGGAAGCTGCCATCTTGCTTGG + Exonic
1155777680 18:29788738-29788760 CAGGAAGCTACCATATTTCTGGG + Intergenic
1156293523 18:35770563-35770585 ACTGAACCTCCCATCTCTGTAGG - Intergenic
1164684170 19:30156212-30156234 ACGGAAGCTCCCGTTTTTGCTGG - Intergenic
1167599813 19:50448062-50448084 CGGGAAGCTCCCATGCTAGTGGG - Intronic
1168101123 19:54141628-54141650 CCAGATGTTCCCTTCTTTGTGGG + Exonic
925145505 2:1580817-1580839 CAGGAAGCCCCCTTCTCTGTGGG - Intergenic
925145629 2:1581395-1581417 CAGGAAGCCCCCTTCTCTGTGGG - Intergenic
925145642 2:1581448-1581470 CAGGAAGCCCCCTTCTCTGTGGG - Intergenic
936103005 2:109600004-109600026 CAGCAAGCTGCAATCTTTGTAGG - Intronic
943236255 2:185324162-185324184 ACGGAAGCTCCTATGTTTGGGGG - Intergenic
1171333373 20:24360883-24360905 CCAGAACCACCCATCATTGTTGG + Intergenic
1172022813 20:31926119-31926141 CCGGGAGCTTCCAGTTTTGTGGG + Intronic
1178395862 21:32242747-32242769 CCAGAAGCTCCCAGTGTTGTGGG + Intergenic
1178818390 21:35952432-35952454 CCGGAGGCTCACAGGTTTGTTGG - Intronic
1179157157 21:38860407-38860429 CAGGAAGAGCCCATCTGTGTGGG - Intergenic
1180731337 22:17984660-17984682 CATGAAGCTTCCATTTTTGTGGG + Intronic
1180954084 22:19733678-19733700 CCAGATCCTCCCATCTTTGAGGG - Intergenic
1181493856 22:23277007-23277029 CCGCATGCTGCCATCTGTGTCGG + Intronic
1182006471 22:26964337-26964359 CATGAAGCTGCCATCTTTATAGG - Intergenic
1183003366 22:34879955-34879977 CCAGAAACTCCCATCCTTGAAGG + Intergenic
953922258 3:46960321-46960343 CAGGCAGCTTCCATCTATGTAGG - Intronic
954760682 3:52871419-52871441 CTGGCATCTCCCATCTTAGTGGG + Intronic
960870489 3:122244552-122244574 CAGGAAAATCCCATCTTTGATGG + Intronic
965756364 3:172031702-172031724 CTGGCAGCTACCATCTTTTTAGG - Intergenic
967102903 3:186230831-186230853 CAGAAAGCTCCCATCTGGGTGGG + Intronic
971151967 4:24043042-24043064 CAGGAAGCTACCAATTTTGTAGG + Intergenic
972264224 4:37443628-37443650 CTGCAAGATCCCATGTTTGTTGG - Exonic
972340564 4:38149144-38149166 CCAAAATCCCCCATCTTTGTGGG - Intergenic
978347829 4:107789566-107789588 CTGGAAGCTTCCATCTTACTTGG + Intergenic
989145273 5:38243231-38243253 CTGGAAACTCCCATCATTCTTGG + Intergenic
1002439544 5:179257228-179257250 CCGGGAGCTCCCAGCATTCTTGG - Intronic
1007728331 6:43930416-43930438 CAGGGAGCTCCCATTTTAGTGGG + Intergenic
1008093871 6:47318871-47318893 CCAGAAGCTTCCTTCTTTCTTGG + Intergenic
1014674715 6:124349297-124349319 CGGGAAGTTCCCGCCTTTGTAGG - Intronic
1018670233 6:166170844-166170866 CTGGATTCTGCCATCTTTGTAGG - Intergenic
1019952201 7:4382758-4382780 CCTGAAGCTCCCCTGTCTGTGGG - Intergenic
1022073822 7:26945775-26945797 CAGGAAGCTTCCATTCTTGTGGG - Intronic
1023967902 7:44972689-44972711 CAGGAAGCTCCCACCTCAGTAGG + Intronic
1024585944 7:50842349-50842371 CCAGAAGTTCCCATCTTTAGGGG - Intergenic
1027192692 7:76006423-76006445 CAGGAAGCTCCCATTTAAGTAGG - Intronic
1027539453 7:79450810-79450832 GCTGAAGTTCCCATCATTGTGGG - Intronic
1028750523 7:94377488-94377510 CTAGAAGCTCCCTTCTTTTTAGG + Intergenic
1036199330 8:6754171-6754193 CTAGAAACTCCCTTCTTTGTAGG - Intronic
1037835726 8:22213795-22213817 CTGGAAGAACCCATGTTTGTGGG - Intergenic
1043456862 8:80420629-80420651 CAGGAAACTCCCATCTTCATAGG + Intergenic
1057276057 9:93676523-93676545 CCGGGAGCTCCCTGCTCTGTTGG + Intronic
1058045538 9:100353051-100353073 CCGGAAGCCCCCTGCTCTGTGGG + Intergenic
1059165795 9:112075375-112075397 CAGGAAGCTCCTATTTTAGTGGG + Intronic
1059330301 9:113530938-113530960 CCTGAAACTCACATCTTAGTTGG + Intronic
1187958693 X:24546279-24546301 CCGGAAACTGCCATCATTATGGG - Intergenic
1188533086 X:31163964-31163986 CTGGAGGCTGCCATCTTTCTTGG - Intronic
1190042709 X:47084160-47084182 CTGGAAGCTCCCAGTCTTGTGGG - Intronic