ID: 1145785307

View in Genome Browser
Species Human (GRCh38)
Location 17:27589699-27589721
Sequence CCAGAAAAAAAGTGCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145785307 Original CRISPR CCAGAAAAAAAGTGCAAGGC TGG (reversed) Intronic
900806115 1:4769427-4769449 CCAGAATAGAAGTGCGAGACTGG + Intronic
901807246 1:11746415-11746437 GCAGAAGACATGTGCAAGGCAGG - Intronic
902330091 1:15727095-15727117 CCAGAAGAAATGTGCCAAGCAGG + Exonic
902741734 1:18443253-18443275 GCAGAAAAAAAATTCAAGGTGGG + Intergenic
903470932 1:23586933-23586955 TCAAAAAAAAAGTCCAAGGCGGG - Intronic
903535901 1:24066175-24066197 CAAGAAAAATAGAGTAAGGCAGG - Intronic
904384878 1:30134658-30134680 CCGAAAAAAAAGTGCAAACCAGG + Intergenic
904526054 1:31134828-31134850 CCAGAAAAAAAAAGTATGGCTGG + Intergenic
906342733 1:44994960-44994982 ACAAAAATAAAATGCAAGGCTGG - Intergenic
906357639 1:45120862-45120884 CAAGAAGAAAAGTGAAAGGAGGG - Intronic
906535156 1:46547448-46547470 CCAGAAAGAAAGGCCAGGGCAGG + Exonic
906633168 1:47389506-47389528 CAATAAAACAAGTGCCAGGCTGG + Intergenic
908512953 1:64863889-64863911 CCAGAAACAATGTGAGAGGCAGG - Intronic
909894516 1:81050475-81050497 CCATAATAGAAGAGCAAGGCTGG + Intergenic
910051464 1:82978929-82978951 CCAGAAAAGCACTGCAAGGTAGG - Intergenic
910194237 1:84624164-84624186 CCCCAAAAAAAGAACAAGGCAGG - Intergenic
912407149 1:109449605-109449627 CCATGACAAAAATGCAAGGCTGG + Intergenic
914715763 1:150253769-150253791 CCAAAAAAAAAGAGAGAGGCTGG + Intergenic
915693373 1:157713634-157713656 CAAGGAAGAAAGTGCAAAGCAGG - Intergenic
915895033 1:159805353-159805375 CCAAAAAAAAAATGCAAGAATGG - Intronic
916664094 1:166949770-166949792 CCAGAAAAAAAATGCATTGAAGG - Intronic
916780858 1:168027022-168027044 GGAGAAAAGAAGTGCAAGGAGGG + Intronic
917551642 1:176037933-176037955 CCAGTACAAAAAAGCAAGGCAGG + Intronic
918258852 1:182775800-182775822 CCAGAAACAAAGTGCCATGTTGG - Intergenic
918655188 1:187016966-187016988 GCAGAAAAAAAGTATAAGCCAGG - Intergenic
918808531 1:189083418-189083440 GCAGAATAAAAGTGAGAGGCGGG + Intergenic
918917329 1:190660169-190660191 CAAGACAAAAAGTGGAAAGCAGG - Intergenic
918940261 1:190985715-190985737 TCAGAAAAATAGGTCAAGGCAGG - Intergenic
919170321 1:193945875-193945897 CCAGAGAAAAAGAGCAAGAGAGG + Intergenic
919945047 1:202312930-202312952 AGAAAAAAAAAGTGTAAGGCCGG + Intronic
920694138 1:208169025-208169047 CATGAAAAAGAGTGCAAGCCGGG - Intronic
920845512 1:209590098-209590120 CCAGAAATAGAGTGAGAGGCGGG + Intronic
921609216 1:217191004-217191026 GGAGCAAAAAAGTGCAAGGGGGG + Intergenic
922222196 1:223617260-223617282 CCAAAAAAAAAGTGGAAGTGGGG - Intronic
922704342 1:227781199-227781221 CCAGAAATAAAGGGAAATGCTGG + Exonic
923621009 1:235579446-235579468 CCAGAAAACAAGTGCTGGTCAGG + Intronic
923833636 1:237585235-237585257 CCAGAAAATAAATCCAAGTCTGG - Intronic
924863403 1:247951228-247951250 CCTGAAAAAAAGAGCAAAGCTGG - Intronic
1064436163 10:15312989-15313011 AGAATAAAAAAGTGCAAGGCCGG - Intronic
1064536902 10:16366523-16366545 CAAGAAAAAGAGGCCAAGGCAGG + Intergenic
1066583029 10:36901304-36901326 ACAGAAAAGAAGTACAGGGCAGG + Intergenic
1066702703 10:38146845-38146867 ACAGAAATAAAGTGCAAAGTGGG + Intergenic
1066797106 10:39134546-39134568 CCAGAAAAAAACTAGAAAGCAGG + Intergenic
1066802888 10:39209594-39209616 CCAGAAAAAATCAGCAAGTCAGG - Intergenic
1066988177 10:42486934-42486956 ACAGAAATAAAGTGCAAAGTGGG - Intergenic
1066988965 10:42494516-42494538 ACAGAAATAAAGTGCAAAGTGGG - Intergenic
1067212773 10:44274642-44274664 CTAGAAAAAAAATGCAATGTAGG - Intergenic
1067553577 10:47252563-47252585 CAAGCAAAGAAGTTCAAGGCAGG + Intergenic
1067606283 10:47666202-47666224 CCAACAAAAAAGTGGGAGGCGGG - Intergenic
1068292771 10:55026546-55026568 ATAGAAATACAGTGCAAGGCAGG + Intronic
1068663147 10:59645038-59645060 GAAGAAAAAAAGTGCCAGCCAGG - Intergenic
1068667326 10:59690790-59690812 CCAAAAAAAAAAGGCCAGGCAGG + Intronic
1069155598 10:65026938-65026960 ACAGAAAAATGGTGTAAGGCGGG + Intergenic
1069190924 10:65488695-65488717 CCAAAACAAAAGCCCAAGGCTGG + Intergenic
1069485477 10:68819853-68819875 AAAAAAAAAAAGAGCAAGGCCGG - Intergenic
1069930383 10:71877804-71877826 CCAGAAAAAAAGAGTGATGCTGG - Intergenic
1070604622 10:77890041-77890063 CCACAACAAATGTGGAAGGCAGG + Intronic
1071621842 10:87127555-87127577 CCAACAAAAAAGTGGGAGGCGGG - Intronic
1071914577 10:90277694-90277716 ACAGAAAAAAAGAGCAAGTCTGG - Intergenic
1072418789 10:95271785-95271807 CTAGAAAAAAAGGGGAAAGCAGG + Intronic
1072728450 10:97829057-97829079 CCAGACAGAAAGAGCAAGGTGGG - Intergenic
1072938869 10:99741083-99741105 CCAATAAAAAATTACAAGGCAGG - Intronic
1074727898 10:116333043-116333065 CTAGAAAACAAGAGCAAGGAAGG - Intronic
1077411597 11:2406332-2406354 CCAGAAAGACGGTGCAGGGCAGG + Intronic
1077588505 11:3473145-3473167 TCAGAAATAATGTGGAAGGCCGG + Intergenic
1078026648 11:7701811-7701833 CCTGAAGAAAAGAGCAAGGTAGG + Exonic
1078054768 11:7999265-7999287 CAAGAAAAAAAGTGAAAAGGAGG + Exonic
1078162808 11:8856585-8856607 CAAAAAAAAATGTGCAAGGTTGG + Intronic
1078616848 11:12873926-12873948 CCAGCAATATAGTGCAAGGGAGG - Intronic
1079711160 11:23683473-23683495 TCAAAAAAAAAGTATAAGGCAGG + Intergenic
1080702102 11:34652725-34652747 ACAGAAAAAAAGAGGAAGGAAGG - Intronic
1081253782 11:40868013-40868035 CCAGAAAAAGAGAGCTAGGGAGG + Intronic
1082831247 11:57619341-57619363 CCAGAGTAGAATTGCAAGGCAGG - Intergenic
1082975798 11:59070479-59070501 CCATGCAAAAAGTGCATGGCTGG - Intergenic
1083825389 11:65200341-65200363 CCAAAAAAAAAGAACAAAGCTGG - Intronic
1084269390 11:68021004-68021026 TCAGAAAAAAAGGGCTGGGCAGG + Intronic
1087720303 11:101657001-101657023 CCAAAATAAAAATGCATGGCTGG - Intronic
1090164931 11:124536615-124536637 CCAGAAAACAGGAGCATGGCAGG + Intergenic
1090816611 11:130302671-130302693 CCAGTAAAAAAGTGAAATGAGGG + Intronic
1093105233 12:15078381-15078403 CAACAAAAAAAGTCCAAGACTGG + Intergenic
1093503977 12:19843496-19843518 CAAGAAAAAGAGTTCTAGGCCGG + Intergenic
1093725627 12:22505041-22505063 TCAGAAAAACAGTGCGAGTCAGG - Intronic
1094061412 12:26318525-26318547 CCAGAAAGAAAAAGGAAGGCAGG + Intergenic
1094666830 12:32528385-32528407 CAAAAAAAAAAGTGTAAGGGAGG - Intronic
1095159515 12:38900592-38900614 CCAGAAAAGAAGGGGAAGGGAGG + Intronic
1096265258 12:50117556-50117578 ACAGAAAAAGAGTGCCAGGGTGG - Intronic
1097041148 12:56156752-56156774 AAAAAAAAAAAGTACAAGGCTGG + Intronic
1097282035 12:57850881-57850903 ACAGAAAATAAGTACAAGGTTGG + Intergenic
1097298729 12:57995852-57995874 CCTGAAAAAAAGAACAAAGCTGG - Intergenic
1098331605 12:69359604-69359626 CCAAAAAAAAAATGAAAGGCAGG - Intergenic
1098496283 12:71139333-71139355 CCAGAAGCAAAGGGCAAGACAGG - Intronic
1099003790 12:77213422-77213444 CAAGAAAAAAAGTGGGAGGGAGG - Intergenic
1099860174 12:88216647-88216669 CCAAAAAAAAAGCCCAGGGCTGG + Intergenic
1100826911 12:98483383-98483405 CCAGAAAGAAAGTGAAGGCCAGG + Intergenic
1100864700 12:98844425-98844447 CCAGGGAAAAGGTGCATGGCTGG - Intronic
1100932574 12:99626875-99626897 CCAGAAATAAAGAACAAGGTTGG + Intronic
1101708904 12:107246970-107246992 ACAGAAAAAAAGTAGAAGGGTGG + Intergenic
1106263042 13:28085048-28085070 CCTGAAAAGATGTGCAAGCCGGG + Intronic
1108074118 13:46661103-46661125 CCAGGAAAACAGTGGAAGGAGGG - Intronic
1109659021 13:65434770-65434792 CAAGAAAAAAAGTGATAGGTTGG - Intergenic
1110472615 13:75876849-75876871 CCAGGAAAACTGTGCAAGGCGGG + Intronic
1110534471 13:76635257-76635279 CCAGAAAAGAAGGGTAAGGAAGG + Intergenic
1111322056 13:86644349-86644371 CCTGATAAAAAGTGAATGGCAGG - Intergenic
1111335033 13:86809980-86810002 CAACAAAAAAATTGCAAGGCAGG - Intergenic
1112134607 13:96563049-96563071 AAAAAAAAAAAGTCCAAGGCTGG + Intronic
1112700366 13:102000977-102000999 CTAGAACAAAAGTTCAAGGCTGG + Intronic
1112992834 13:105534910-105534932 CCTGAAAACAAGAACAAGGCTGG - Intergenic
1113296449 13:108964189-108964211 CAAGGAAAAAAGAGCAAGGGTGG - Intronic
1113719753 13:112546269-112546291 CCAAAAAAAAAGTACAAGGATGG - Intronic
1113757967 13:112827184-112827206 GCAGAAGCAGAGTGCAAGGCTGG - Intronic
1115323417 14:32110494-32110516 CCACTACAAAAGTGCAAGGCAGG + Intronic
1115754073 14:36516551-36516573 CCATAAAAAATGTGAAGGGCTGG + Exonic
1115791258 14:36881573-36881595 GTAGAAAAAAAGGGCAAGGGTGG - Intronic
1116916515 14:50531704-50531726 CCACAAAAAAAGTGCAACAGCGG + Intronic
1118054046 14:62059523-62059545 CCAGAAAAAAATTGCTAAGTTGG - Intronic
1119448800 14:74689890-74689912 AAAGAATAAAAGTGCTAGGCCGG - Intronic
1119532763 14:75374416-75374438 CCAGAAAGAAAGGCCATGGCTGG - Intergenic
1120946190 14:89999860-89999882 ACAGAAAACTAATGCAAGGCTGG - Intronic
1121882384 14:97512550-97512572 TCAGAAAATATGTTCAAGGCAGG - Intergenic
1123715023 15:23021615-23021637 ACAGAAACAAAGTGGAATGCTGG - Intronic
1124253575 15:28122906-28122928 GGAGAAAAAAAGTGAGAGGCAGG - Intronic
1124368447 15:29090151-29090173 GCTGAACAAAAGAGCAAGGCAGG + Intronic
1126436932 15:48645972-48645994 CAAGACAAAAAGTCCCAGGCCGG - Intergenic
1126718708 15:51552574-51552596 CAAGAAAAAAGGTTCAAGGAGGG - Intronic
1129306084 15:74664159-74664181 ACATAAAATAAATGCAAGGCAGG + Intronic
1129910112 15:79220028-79220050 CCAGAGAAAGAGTGCCAGGATGG - Intergenic
1129983737 15:79897398-79897420 CCAGAAAAGAAGGGCAAGGCAGG + Intronic
1130424850 15:83786270-83786292 TCAGAAAAAAAGTTCAAACCAGG - Intronic
1130524058 15:84688603-84688625 CAAGAAATAAAGTTCAACGCAGG + Intronic
1131327880 15:91466451-91466473 CAAGAAAAGAAGTGGAAGGGAGG - Intergenic
1132658946 16:1053121-1053143 CCAGACCCAAAGTGCACGGCCGG - Intergenic
1133238179 16:4398671-4398693 AAAAAAAAAAATTGCAAGGCTGG + Intronic
1133772284 16:8874179-8874201 TCAAAAAAAAAATTCAAGGCCGG - Intergenic
1134838120 16:17379067-17379089 CCAGAAACAAAGGAAAAGGCAGG + Intronic
1135684143 16:24484445-24484467 ACAGAAAATAAATGCAAGGCAGG + Intergenic
1135906476 16:26516727-26516749 ACAGAAAAAAAGTGAAGGCCAGG + Intergenic
1136049434 16:27640006-27640028 GTAGAAAAAAAGAGCAAGGCTGG - Intronic
1136594575 16:31239264-31239286 CCAGAAAAAAAAAAAAAGGCTGG + Intergenic
1137278305 16:46952621-46952643 ACAAAAAAAAAGACCAAGGCCGG + Intergenic
1139704148 16:68729006-68729028 CCAAAAACAAAATGCAGGGCTGG + Intergenic
1140888900 16:79268472-79268494 GCATAGTAAAAGTGCAAGGCTGG + Intergenic
1141185960 16:81787522-81787544 AAAAAAAAAGAGTGCAAGGCTGG - Intronic
1141542574 16:84737400-84737422 ACAGAATAAAAGTGCCAGGATGG - Intronic
1142377585 16:89714232-89714254 AAAAAAAAAAATTGCAAGGCTGG - Intronic
1142771385 17:2099859-2099881 CCAGAAAAAAAGTGGAGTTCGGG - Intronic
1143134179 17:4701869-4701891 GTAGAAAAAAAATTCAAGGCAGG + Intronic
1143830170 17:9645195-9645217 CAGGAAGAAAAGGGCAAGGCAGG - Intronic
1144417179 17:15060598-15060620 ACACAAAAAAAGTCCAAGCCTGG + Intergenic
1144542516 17:16158268-16158290 TCAGTTAAAAAGTTCAAGGCGGG - Intronic
1145004017 17:19326696-19326718 AAAAAAAAAAAGTGCAAGGACGG + Intronic
1145785307 17:27589699-27589721 CCAGAAAAAAAGTGCAAGGCTGG - Intronic
1146619634 17:34387425-34387447 GCAGAAAAAGAGTGCCAGGCAGG + Intergenic
1146642941 17:34554959-34554981 CCCGAACAAATGAGCAAGGCTGG + Intergenic
1146983507 17:37189393-37189415 GCAGAAACAAACTGCAAGGGTGG - Intronic
1148864178 17:50620006-50620028 CCAGAAAAGAGCTGGAAGGCAGG + Intronic
1149906043 17:60527318-60527340 CAAGTAAAAAACTACAAGGCTGG + Intergenic
1150379665 17:64710579-64710601 CTAAAAAAAAAATACAAGGCTGG + Intergenic
1150800725 17:68280339-68280361 CCTGAAAAAAAGAACAAAGCTGG + Intronic
1150863020 17:68820925-68820947 CCAGAAAAGGAGATCAAGGCAGG - Intergenic
1151792263 17:76314664-76314686 ATAGGAAAAAAGTGTAAGGCTGG - Intronic
1154937798 18:21078601-21078623 CCAGAACAAAAGACCAAAGCAGG + Intronic
1155744167 18:29330670-29330692 TCAGAGAAAAAGTGCTATGCTGG - Intergenic
1156437074 18:37143307-37143329 CCACAAAAAATGTGTAAGACTGG - Intronic
1156992724 18:43429543-43429565 CCAAAAAAAAATTGCCATGCAGG - Intergenic
1157727151 18:49973563-49973585 TCAGAAAAGAAGTGCAAGGTAGG + Intronic
1159513329 18:69425107-69425129 CCAGGCAAAAAGTGCAAGGAAGG + Intronic
1161078064 19:2296095-2296117 CCAGAAAAACAGTGCTGGGAGGG - Intronic
1161113128 19:2480758-2480780 CCACAAAAGATGTGGAAGGCTGG + Intergenic
1161113842 19:2485761-2485783 CCACAAAAGATGTGGAAGGCTGG + Intergenic
1161819903 19:6523664-6523686 CAAGAAAAAAAAAACAAGGCCGG - Intergenic
1161823954 19:6549790-6549812 CCAAAATAATTGTGCAAGGCTGG + Intergenic
1161956525 19:7499009-7499031 CCAGTAAGAAAGTGCGTGGCAGG + Intronic
1162045225 19:7994963-7994985 CAAAACAAAAAGTGCAAGGAAGG + Intronic
1163805606 19:19395156-19395178 ACAGAAAATACGTTCAAGGCCGG + Intronic
1164010132 19:21194861-21194883 CCAGAAACAAGAGGCAAGGCAGG + Exonic
1164515667 19:28933307-28933329 CCAGAACAAAGGTGAAAGCCTGG - Intergenic
1164968094 19:32504550-32504572 CGAGAGAAAAAGAGAAAGGCAGG - Intergenic
1165042521 19:33079411-33079433 CCATAAAAAAAGAACAAGACTGG + Intergenic
1165106751 19:33474682-33474704 TCAAAAAAAAAGTGCCAGGCTGG + Intronic
1165565943 19:36727673-36727695 CTAGATAAGAATTGCAAGGCCGG - Intronic
1166600845 19:44093371-44093393 TCTCAAAAAAAGTGCCAGGCTGG - Intergenic
1166841890 19:45702465-45702487 AAAAAAAAAAAGTGCCAGGCTGG + Intronic
1167716653 19:51146626-51146648 CCAGAAACAAAGGGCAAGAATGG - Intronic
1167905227 19:52654891-52654913 CCAGAACAAAAGGCCAAGGGTGG + Intronic
1168143494 19:54405361-54405383 AAAAAAAAAAAGTGCAATGCAGG + Intergenic
925238598 2:2301153-2301175 CGAAGAGAAAAGTGCAAGGCTGG - Intronic
925519625 2:4728801-4728823 CCAAAGAAAAAGTACAAGGAAGG + Intergenic
925923559 2:8654354-8654376 GCAGAGAGAAAGGGCAAGGCAGG - Intergenic
926676927 2:15632749-15632771 GCAGGAAAAAAGAGCAAGTCAGG - Intergenic
926858459 2:17282560-17282582 CCAGAAAAAGACTCCTAGGCAGG + Intergenic
926951434 2:18247842-18247864 CCAGCAAGAAAGTGGCAGGCTGG - Intronic
926968209 2:18439279-18439301 CAAGGAAAAAAGAGAAAGGCAGG - Intergenic
928861692 2:35865440-35865462 CTAGAAATAAAGAGAAAGGCCGG + Intergenic
929158078 2:38805807-38805829 TCAGAAAAAAACTGCAGGTCTGG + Intronic
930343542 2:50148801-50148823 TCAGACAACAATTGCAAGGCAGG - Intronic
931013535 2:57947717-57947739 ACAGAAAAAAAGTGTGAGTCAGG - Intronic
932227042 2:70049985-70050007 ACTGAAAAAAAATACAAGGCTGG + Intergenic
933753018 2:85615385-85615407 CAAGCAAACAAGTTCAAGGCAGG + Intronic
933845168 2:86319924-86319946 CCAGAAGATAAGAGAAAGGCAGG + Intronic
936259074 2:110942876-110942898 CCTGAAAAAAAAAGGAAGGCAGG + Intronic
936609725 2:113990118-113990140 ACAGAATAAAAGAGCAAGGAAGG - Intergenic
937048631 2:118869446-118869468 CCAAAAGAAAAGTGAAAGGCAGG - Intergenic
937675820 2:124589002-124589024 CCTGAAAAAAAGTTAAAGGATGG - Intronic
938745334 2:134272567-134272589 TCAGAAAAAAATTGGGAGGCAGG + Intronic
940011177 2:149057379-149057401 AAAAAAAAAAAGTGCAGGGCAGG - Intronic
940041511 2:149366538-149366560 CCAGAGAAAAAGAACAAGGATGG + Intronic
940107620 2:150116666-150116688 TCAGGAATAAAGTGGAAGGCCGG - Intergenic
940586640 2:155660147-155660169 CCAGCAAAAAACTGGAAGTCAGG + Intergenic
941525861 2:166606117-166606139 CTAGAAATAAAATGAAAGGCAGG + Intergenic
943944150 2:194037025-194037047 TCATAAAAAAAGCGCCAGGCTGG + Intergenic
946109176 2:217399045-217399067 CCAGAGAGGAAGCGCAAGGCGGG + Intronic
946292547 2:218756142-218756164 CCACAACAAAACTGCCAGGCAGG - Intergenic
946724982 2:222653407-222653429 CAAGAAAAAAAGAGGAAGACTGG + Intronic
947845957 2:233243911-233243933 CCAAAAGAAAGGTGGAAGGCTGG + Intronic
948077601 2:235177950-235177972 ACAAGAAAATAGTGCAAGGCTGG - Intergenic
948245547 2:236481186-236481208 CCAGAGACAAAGGGAAAGGCAGG - Intronic
948286914 2:236793217-236793239 CCAGAGAAACAGCGCAAGCCGGG + Intergenic
1169486421 20:6037877-6037899 TCAGAAACACAGTGGAAGGCAGG - Exonic
1170765651 20:19288033-19288055 CCAGAAATACAGTGGAAGGTAGG + Intronic
1170815422 20:19709622-19709644 AGAAAAAAAAAGTGCTAGGCAGG + Intronic
1173016687 20:39232301-39232323 GCAAGAAAAAAGTGCAGGGCTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174467519 20:50729738-50729760 CCGGAAATAAAGTGCATGTCAGG - Intergenic
1174478978 20:50817706-50817728 CCAAAAAAAATGTGTGAGGCGGG - Intronic
1174597396 20:51694876-51694898 CAAGAAAAAAAGAGCATGTCAGG + Intronic
1175415345 20:58797202-58797224 CCAGAAAACACTTGTAAGGCCGG - Intergenic
1175678908 20:60970334-60970356 CCACAAAGAAAGTTCAAGGCTGG + Intergenic
1177044072 21:16147449-16147471 TCAGAAAAAAAGTTGAAAGCTGG + Intergenic
1177231028 21:18319723-18319745 CTTGAAAAATAGTGAAAGGCCGG - Intronic
1178364126 21:31974321-31974343 GCAAAAAAAAAATGCAAGGATGG + Intronic
1179131839 21:38644399-38644421 TCAGAAAACAAGTGGAAGCCAGG - Intronic
1179145722 21:38765818-38765840 CCAGACTCAAGGTGCAAGGCTGG + Intergenic
1179252934 21:39688378-39688400 CCAGAGAAAAGGTGCATGACAGG + Intergenic
1180989403 22:19925868-19925890 CCATCAAGAAAGTGCAGGGCCGG + Intronic
1181094047 22:20494084-20494106 CAAAAAAAAAAGTGCAAAGTAGG + Intronic
1182700757 22:32235887-32235909 GCAAAATAAATGTGCAAGGCAGG + Intronic
1182843443 22:33410741-33410763 CCAGAAAGAGATTGCAAGGTAGG + Intronic
1182922849 22:34096089-34096111 ACAAAAAAAAACAGCAAGGCAGG - Intergenic
1183248415 22:36711320-36711342 CCAGATACCACGTGCAAGGCAGG - Intergenic
1183514848 22:38259150-38259172 CCCGAAATAAACTCCAAGGCAGG - Intronic
1183697398 22:39431003-39431025 CCAGAAGGAAAATGCAAGGCAGG - Exonic
1183995496 22:41630276-41630298 TCAAAAAAAAAAAGCAAGGCCGG - Intronic
1184380006 22:44139419-44139441 ACAATAAAAAAATGCAAGGCTGG - Intronic
1184753877 22:46505272-46505294 AAAAAAAAAAAGAGCAAGGCAGG + Intronic
949301611 3:2590501-2590523 CAAGCAGAAAAGTGCGAGGCAGG - Intronic
950110397 3:10414936-10414958 CCAGAATCAAAGTCCAAGGTGGG + Intronic
951469773 3:23044018-23044040 CCAGAAAACATGGGCAAGGGTGG - Intergenic
952142893 3:30499311-30499333 CCAGAAAAGAAGTGCAAGAGGGG - Intergenic
952160910 3:30692194-30692216 CCAGAAGAGAAGTGCTAGGCAGG - Exonic
952297988 3:32077858-32077880 GCAGAAAAAAAGACTAAGGCAGG - Intergenic
952381494 3:32808872-32808894 CCAGAAAAAAATTTTAAGGCCGG - Intergenic
952627383 3:35423106-35423128 CCAGAACAAGAGAGAAAGGCTGG - Intergenic
952838726 3:37626673-37626695 TCAAAAAAAAAGTGGAAGGTGGG + Intronic
952930732 3:38359027-38359049 CCAGAAATAAAGTGCAGTGTGGG + Intronic
953290483 3:41656033-41656055 GCAGAAAAAAACTGCATGGGTGG - Intronic
953594192 3:44292640-44292662 CAATAAAAAAAGTGAAAAGCTGG - Intronic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
954366988 3:50151504-50151526 CCAGAAACAAAGTCCAGGCCAGG + Intergenic
956390381 3:68765988-68766010 CCATAAAAAAGGTACAATGCTGG + Intronic
957133917 3:76260123-76260145 CCTGCAGAAAAGTGCAATGCTGG + Intronic
957826909 3:85459091-85459113 CCAGAAAACAACTGAAAGCCAGG - Intronic
958594596 3:96205210-96205232 TCAGCAAAAAAGAGCAAAGCTGG + Intergenic
959792250 3:110375879-110375901 CTAGAAAAAAAGTTCAATGATGG + Intergenic
960395201 3:117129354-117129376 CAAGAAAACAAGAGCAGGGCAGG - Intronic
966754687 3:183357848-183357870 CCAGAAAAAAAAAAAAAGGCCGG + Intronic
967599524 3:191369015-191369037 CTAGAAAAACAGTCTAAGGCTGG - Intronic
967770556 3:193329790-193329812 CCAGACAAAAAGGACAAGGATGG - Intronic
968065789 3:195758361-195758383 CCAGACAAAAAGAGCAAGAAAGG + Intronic
968898888 4:3421522-3421544 CCAGAAACACACGGCAAGGCCGG - Intronic
969431161 4:7155094-7155116 CCAAAATAAAAATGCAGGGCGGG - Intergenic
971849370 4:31963632-31963654 CTAGAAAAAAAATGCAATGTTGG + Intergenic
972752128 4:42000554-42000576 CAAGAAAATAAGTTCTAGGCCGG + Intronic
975027061 4:69563101-69563123 TCAGAAAAAAAGAACAAAGCTGG - Intergenic
975472265 4:74783541-74783563 CCAAACAAAAAGTACAAGGCTGG - Intronic
975617981 4:76266416-76266438 CCAGAAAAAAACTGGAAAGATGG - Intronic
975915928 4:79325507-79325529 TTAGAATAAAGGTGCAAGGCTGG + Exonic
977763879 4:100774831-100774853 ACAGAAAAAAAGTACAAAGAAGG - Intronic
977786014 4:101035657-101035679 AAAGAAAAAAAGAGCAAGGAAGG - Intronic
977911221 4:102539282-102539304 GAAGAAACAAAATGCAAGGCTGG - Intronic
978211117 4:106136398-106136420 CCAGAAAAGAAGTGGAAAACTGG + Intronic
979533067 4:121789442-121789464 CCAAAAAAAAACTGAAAGGAGGG - Intergenic
979566890 4:122164384-122164406 CCAGAATAAAAGTGAAAGTCTGG + Intronic
980118372 4:128703328-128703350 AAAAAAAAAAAGTACAAGGCTGG - Intergenic
980572303 4:134636738-134636760 TCTGAAAAAAAGTCCAAGTCAGG + Intergenic
980950789 4:139373999-139374021 CAGGAAAAAAAATGCTAGGCTGG - Intronic
982256246 4:153454163-153454185 CAAGAAAAAAAGTCCATGGGAGG + Intergenic
982742260 4:159069649-159069671 ACAGAAAATAAGTACCAGGCTGG - Intergenic
984447395 4:179854152-179854174 ACAGAAAAAAAATGCAATGAGGG + Intergenic
986071306 5:4287486-4287508 CCAGTTAAAGAATGCAAGGCAGG - Intergenic
986334635 5:6744850-6744872 CCATGAAAATAGTGCAAGTCAGG - Intronic
987492618 5:18599831-18599853 CAAGAACAAAAGGACAAGGCAGG + Intergenic
987977381 5:25032137-25032159 CAAGAAAAAAAGAGCAAAGCCGG - Intergenic
988915316 5:35887628-35887650 CAAGCAGAAAAATGCAAGGCTGG + Intergenic
989009991 5:36859178-36859200 TCAGGCAAAAAGAGCAAGGCTGG - Intergenic
990005656 5:50941451-50941473 CCAACAAAAAAGTTCAAGACCGG + Intergenic
990136777 5:52654810-52654832 CCAGAAACAAAATGCAGGGAAGG + Intergenic
992108221 5:73468139-73468161 CCAGAAAAACAGAGCAAGAATGG + Intergenic
993774640 5:91976340-91976362 TCAAAAAAAATGTGCAAAGCTGG + Intergenic
995322097 5:110846938-110846960 ACAGAAAAAAAGTACAAACCAGG - Intergenic
996484102 5:124011098-124011120 CTACAAAATAACTGCAAGGCAGG - Intergenic
996885557 5:128350098-128350120 CTAAATAAAAAATGCAAGGCAGG + Intronic
997112861 5:131094145-131094167 CCATTAAAAAAGTTTAAGGCTGG - Intergenic
997164313 5:131642571-131642593 AAAAAAAAAAAGTACAAGGCTGG + Intronic
997326118 5:133022956-133022978 CCAGAAAATCAATACAAGGCAGG + Intronic
997390927 5:133514796-133514818 CCAGAATAAAAGTCTAAGGGAGG - Intronic
1000641777 5:163711609-163711631 CCAGTCATAAAATGCAAGGCTGG - Intergenic
1001674643 5:173501834-173501856 AAAGAAAAAAAGTCCAGGGCGGG - Intergenic
1002419994 5:179140499-179140521 CCAGGAATAAAGTCCAATGCTGG + Intronic
1003013024 6:2444221-2444243 CCAAAAGAAAAATGCAAAGCTGG - Intergenic
1003718645 6:8675233-8675255 AAAAAAAAAAAGGGCAAGGCTGG + Intergenic
1003914881 6:10777433-10777455 CCAAAAAGGAAGTGCAAGGTAGG + Intronic
1004803242 6:19174204-19174226 CCTGGAAAAAAGTTCAAGGGGGG + Intergenic
1004896506 6:20153128-20153150 GCAAAAAACAAGAGCAAGGCTGG - Intronic
1005382048 6:25245608-25245630 CCAATAAAACTGTGCAAGGCTGG - Intergenic
1005955614 6:30661396-30661418 GGAAAAAAAAAGTGGAAGGCAGG + Intronic
1005958887 6:30682807-30682829 CCAGGAAGCAAGTGCAGGGCAGG - Intronic
1006357245 6:33567187-33567209 CCAGAAAAAATGTGCCAGGTTGG - Intergenic
1006671787 6:35734051-35734073 CCAGAAAACAAGTGAAAGCCAGG + Intergenic
1006872415 6:37263878-37263900 TAAGAAAAAAAGTGTTAGGCCGG - Intronic
1007101768 6:39253377-39253399 CCAGAATCAGGGTGCAAGGCTGG - Intergenic
1007339041 6:41178424-41178446 CGAGAAACAAAGTGAAAGGATGG - Intergenic
1008243708 6:49145009-49145031 TAAAAAGAAAAGTGCAAGGCTGG - Intergenic
1008458462 6:51739774-51739796 CAAAAAAAAAAGTGGAAGGGAGG - Intronic
1009264833 6:61540507-61540529 ACAGAAAAAAAGAGCAAAGATGG + Intergenic
1009459929 6:63900350-63900372 CCAGAAAATAAGTACAATGGGGG + Intronic
1010610276 6:77946224-77946246 CCAGAAGAAATGGGCAAGGCAGG - Intergenic
1012509505 6:99986964-99986986 CCAGAAGAAAAAAGCAAGGAAGG - Intronic
1012989252 6:105908233-105908255 CAAGATTAAAAGTGCAAGACAGG - Intergenic
1014374275 6:120652891-120652913 CCAGAAAAAAAATGGAAGGTAGG + Intergenic
1015848001 6:137541910-137541932 CCAGATAAAAAGGGCAAACCAGG - Intergenic
1016954208 6:149610747-149610769 CAAGAAAAAAAGTCTCAGGCTGG + Intronic
1017988838 6:159469011-159469033 AAAGAAAAAAAGAGAAAGGCAGG + Intergenic
1018277513 6:162148801-162148823 CAAGACAAAAAGTTCAAGGATGG + Intronic
1018875709 6:167820879-167820901 CAAGAAAAAAGGTGAAAGGCTGG + Intergenic
1019986433 7:4659706-4659728 CCAGAGAAAGACTTCAAGGCTGG + Intergenic
1021037870 7:15823392-15823414 ACAGATAAAAAGAGCAAGGCTGG - Intergenic
1021257174 7:18406683-18406705 TTAGAAAAAAAGGGGAAGGCCGG - Intronic
1022550737 7:31236757-31236779 GCAGAAACAGACTGCAAGGCTGG - Intergenic
1023325893 7:39055678-39055700 CAAGAACAAAAGTACAAAGCAGG + Intronic
1023734961 7:43226709-43226731 CCTGAAAGAGAGTGCAAGGGAGG + Intronic
1024261125 7:47574495-47574517 CCAAAAAAAAAATGGAAAGCAGG + Intronic
1024906018 7:54381293-54381315 CCAAAAAATAAGTGCAATGAAGG - Intergenic
1025147242 7:56515416-56515438 CCAGAAAACAAGAGCAAAGCTGG + Intergenic
1025870917 7:65433493-65433515 CCTGTAACAAAGTGCAAAGCAGG - Intergenic
1026166744 7:67916781-67916803 ACAGAGACAAAGTACAAGGCTGG - Intergenic
1026319124 7:69253692-69253714 CCAGAAAACAAGGGCAAAGCTGG - Intergenic
1027252292 7:76406739-76406761 AAACAAAAAAAGTGCAAGACAGG - Intronic
1028117667 7:87018740-87018762 CAAGAAAACAAGTGCATGTCTGG - Intronic
1028590367 7:92486479-92486501 TGAGAAACAAAGTGCAATGCAGG + Intergenic
1031568885 7:123333488-123333510 CCCCAAAAAAAGTCCAGGGCTGG + Intergenic
1031713440 7:125077447-125077469 TCAGAAAAAAAATGCAGGGAGGG - Intergenic
1032440912 7:131942360-131942382 CCTGAAAAAAAATTGAAGGCAGG + Intergenic
1032570600 7:132992099-132992121 CCAGAGGGAAACTGCAAGGCTGG + Intronic
1032639592 7:133750876-133750898 CCATCAAAAAAGTTCAAGGCTGG - Intronic
1032777490 7:135128714-135128736 TCAGAAAAAAAGTGCAGAGAAGG + Intronic
1033541767 7:142363261-142363283 CCAGAAAACAAATACATGGCAGG - Intergenic
1033774336 7:144590591-144590613 CCAGGAAAAAAATGCAAAACTGG + Intronic
1034767077 7:153733959-153733981 CAAGAAACAAAGTACAAGGGAGG - Intergenic
1037182601 8:16025493-16025515 TCAGAAAAAAAGTGTTAGGCTGG - Intergenic
1039565421 8:38548608-38548630 GCAAAAAAAAAATTCAAGGCCGG - Intergenic
1041137048 8:54770233-54770255 CTATAAAAAATGTGTAAGGCTGG - Intergenic
1042147851 8:65750732-65750754 CCAGAAAATAAGAGTTAGGCAGG - Intronic
1042750883 8:72156267-72156289 CCAGAAAGAAAGAGAAAGGAAGG - Intergenic
1043449246 8:80349941-80349963 CCTGAAAAAAAGTGAAAGAATGG - Intergenic
1043885497 8:85595244-85595266 TCAGAAAAAATATGTAAGGCCGG - Intergenic
1043910927 8:85863176-85863198 CCAGAAAAACTCTGAAAGGCTGG - Intergenic
1044479847 8:92672402-92672424 CCAGAAAAAAATTGCTATGGTGG + Intergenic
1045155502 8:99464942-99464964 TAAGAAAAAAAGAACAAGGCAGG - Intronic
1045840743 8:106577796-106577818 CCAGAAGGAAGCTGCAAGGCCGG + Intronic
1047021454 8:120779206-120779228 CCAAAAATAAACTGTAAGGCTGG + Intronic
1047346583 8:124034666-124034688 CCAGGAGGAAAGTGCATGGCAGG + Intronic
1047857417 8:128926708-128926730 CAAGAAGAAAAGGGCAAGACAGG + Intergenic
1048520288 8:135147531-135147553 CCAGAATCAAAGTTCAAGGAAGG + Intergenic
1051440509 9:17077981-17078003 ACACAAAAAAAGGGCAAGGGAGG - Intergenic
1052255832 9:26455387-26455409 CCAGTAAAACAGTGCCAGGGTGG + Intergenic
1053090700 9:35273709-35273731 CCACAAAAAAAACGCTAGGCAGG + Intronic
1056322033 9:85444335-85444357 CAAGCATCAAAGTGCAAGGCAGG - Intergenic
1056463178 9:86827824-86827846 CCAGACAAAAAGTACATGGTGGG - Intergenic
1057925282 9:99141137-99141159 CAAGAAACAAAGTGGAAGACAGG - Intronic
1062075580 9:134586800-134586822 TCAAAAAAAAAGAGCAATGCAGG - Intergenic
1185822424 X:3218430-3218452 CTAGAAAAAAAAAGGAAGGCAGG + Intergenic
1186475795 X:9856787-9856809 CCAGAAGAAAAGGGAAAGGGTGG + Intronic
1189338088 X:40182961-40182983 CCAGAAAAAAATTAAAATGCAGG - Intergenic
1189451246 X:41132869-41132891 CCAGAAAAAAAGCTTAATGCTGG + Intronic
1189957459 X:46289968-46289990 ACAGAAAAACAATGCAAAGCTGG - Intergenic
1190172743 X:48124631-48124653 CCAAAAGAAAAGTGACAGGCTGG + Intergenic
1190179847 X:48182907-48182929 CCAAAAGAAAAGTGACAGGCTGG - Intergenic
1190197249 X:48329866-48329888 CCACAAGACAAGTGCAAGGAAGG + Intergenic
1190659377 X:52640736-52640758 CCAAAAAGAAAGTGACAGGCTGG - Intergenic
1190789018 X:53682742-53682764 CCAGAAACTCAGAGCAAGGCAGG + Intronic
1191029682 X:55955260-55955282 CAAGCAAAAAAGTCCTAGGCAGG + Intergenic
1191265773 X:58391348-58391370 CCAGGAAAAAAGTAGAAGGAAGG + Intergenic
1192724791 X:73737809-73737831 CCAAAAAAAAAGTCCAGGACTGG - Intergenic
1192819475 X:74629338-74629360 TGAGAAAAAAAATGAAAGGCAGG + Intergenic
1193160939 X:78228602-78228624 CCAAAAAAAAAGTCCAGGCCTGG - Intergenic
1193443624 X:81572911-81572933 ATAGAAAAAAAGAGCAAAGCTGG + Intergenic
1194473461 X:94327943-94327965 CCAAAATAAAAATTCAAGGCTGG + Intergenic
1194580737 X:95667136-95667158 GCTGAAAAAAAGAGCAATGCAGG + Intergenic
1195751087 X:108162563-108162585 CAATGAAAAAAGTCCAAGGCTGG - Intronic
1195850165 X:109273996-109274018 ACATAAAAAAAGTGGAAGGAGGG + Intergenic
1197248110 X:124187460-124187482 CCAGAAAAAGAATGCATAGCAGG - Intronic
1198258214 X:134943797-134943819 ACATAAAAGAAGTTCAAGGCCGG - Intergenic
1198277315 X:135107693-135107715 CTAGGAAAAAAGTACAAAGCTGG - Intergenic
1199711523 X:150473103-150473125 ATAGAAACAAAGTGCAAGGCAGG - Intronic
1200944038 Y:8814402-8814424 CCAGAAAAAAACTGAAAAACTGG + Intergenic
1201458708 Y:14199321-14199343 CAAGACAAAATATGCAAGGCAGG - Intergenic