ID: 1145786058

View in Genome Browser
Species Human (GRCh38)
Location 17:27594608-27594630
Sequence GCCCTCCAGGATCCCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145786054_1145786058 6 Left 1145786054 17:27594579-27594601 CCAGAGGCCTCTCATCTCTGAGA 0: 1
1: 0
2: 0
3: 25
4: 270
Right 1145786058 17:27594608-27594630 GCCCTCCAGGATCCCACTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 182
1145786052_1145786058 22 Left 1145786052 17:27594563-27594585 CCATACAGTGGTGGTGCCAGAGG 0: 1
1: 0
2: 2
3: 20
4: 156
Right 1145786058 17:27594608-27594630 GCCCTCCAGGATCCCACTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 182
1145786055_1145786058 -1 Left 1145786055 17:27594586-27594608 CCTCTCATCTCTGAGAGCAGTGG 0: 1
1: 0
2: 1
3: 33
4: 276
Right 1145786058 17:27594608-27594630 GCCCTCCAGGATCCCACTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145786058 Original CRISPR GCCCTCCAGGATCCCACTGA AGG Intronic
900356561 1:2267899-2267921 GACCTCCAGCCTCCCACTGGAGG - Intronic
900594499 1:3474578-3474600 GCCCTGCAGGAGCCCCCTGGGGG + Intronic
901973227 1:12924737-12924759 TCCCTCCAAGATCCCAATTAGGG + Intronic
902011950 1:13277026-13277048 TCCCTCCAAGATCCCAATTAGGG - Intergenic
902916439 1:19642935-19642957 GTGCTCCAGGATCACACTGGAGG + Intronic
902916460 1:19643079-19643101 GTGCTCCAGGATCACACTGGAGG + Intronic
903250938 1:22052834-22052856 GCCCCCCACGATCCCGCAGACGG - Exonic
903537371 1:24076020-24076042 GCCCTCCAGCAAGCCCCTGAGGG - Intronic
903560104 1:24220720-24220742 GCCCTCCAGGAGCTGACTGTGGG - Intergenic
904434400 1:30484913-30484935 GGTCTCCAGGATTCCACTCAGGG + Intergenic
904471384 1:30738674-30738696 GCCCTGCATGATCCCAGAGAGGG - Intronic
904604457 1:31691211-31691233 GGCCACCTGGATCCCCCTGAGGG + Exonic
905092326 1:35439503-35439525 GCCCTCAGGGATTTCACTGATGG + Intronic
905761105 1:40558958-40558980 GCCGTGCAGGAGCCCACTGCGGG + Intergenic
906804190 1:48764186-48764208 GCCTTCCAGGGTTACACTGACGG - Intronic
908029836 1:59987521-59987543 GCCCTCCAGGACCACACAGTCGG + Intronic
913987134 1:143575339-143575361 GCCGTGCAGGAGCCCACTGTGGG - Intergenic
914928101 1:151906421-151906443 GCCGTGCAGGAGCCCACGGAGGG - Intronic
915342446 1:155184036-155184058 GCACTCCAAGAGCCCACGGAAGG - Exonic
916347005 1:163804330-163804352 GCTCTCCAAGATTCCAGTGAAGG - Intergenic
917633446 1:176912984-176913006 ACCATCCATGATCCCACGGAAGG + Intronic
919288190 1:195593299-195593321 GCCCTCATGGATGACACTGAGGG - Intergenic
919293475 1:195663778-195663800 GCCCTCCAGCATACCACCAACGG - Intergenic
919357187 1:196538221-196538243 GCCACCCAGGTTCCCACCGAAGG + Intronic
919554063 1:199029470-199029492 TCAGTCCAGGAACCCACTGATGG - Intergenic
920053728 1:203178409-203178431 GCCCTCCAGCCTCCCAGTGAGGG - Intergenic
920537616 1:206749399-206749421 GCCCTCAATGATCCTACAGATGG - Intergenic
923414089 1:233737906-233737928 GCCCACCAGGATTCCACCAAAGG + Intergenic
924624240 1:245686573-245686595 GCTGTCCAGGACCCCGCTGATGG - Exonic
1063250042 10:4264243-4264265 GCCCCCCAGGATCCCAAGCATGG + Intergenic
1063790109 10:9435048-9435070 GCCCTCCATGTTCCCATTAACGG - Intergenic
1065320923 10:24509382-24509404 GCCTTACAGGATCCTGCTGAGGG - Intronic
1066367461 10:34791364-34791386 GCTCCCCAGCATCCCACTGTGGG + Intronic
1066604159 10:37142876-37142898 CCCAGCCAGGATCCCACTTATGG + Intronic
1067819715 10:49518077-49518099 GCAAACCAGGATCCAACTGAAGG + Intronic
1070853482 10:79586150-79586172 GCCCTCCCGGTTCCCATTCAGGG + Intergenic
1071451278 10:85793227-85793249 TCCCTGCAGGATGCCACTCAAGG - Intronic
1075504961 10:123013578-123013600 GCCGTGCAGGAGCCCACTGGCGG + Intronic
1076408002 10:130226203-130226225 GCCTTCCAGGATCCCCGGGAGGG - Intergenic
1076464291 10:130667582-130667604 TCCATCCAGGATCCAGCTGATGG - Intergenic
1076720818 10:132392040-132392062 GTACCCGAGGATCCCACTGAGGG + Intergenic
1077171638 11:1168907-1168929 GGCCTCCACCACCCCACTGAGGG - Exonic
1079573294 11:21971253-21971275 ACCCTCCAGGATGGCATTGAGGG + Intergenic
1079610854 11:22431175-22431197 GCCCTGCAGTATCACACTCAAGG - Intergenic
1079731714 11:23942354-23942376 GCCGCACAGGATCCCACGGAGGG + Intergenic
1082734960 11:56845477-56845499 GCCCGGCAGGAGCCCACTGCAGG - Intergenic
1084490329 11:69474994-69475016 GCCTTCCCGGACCCCACTGTTGG - Intergenic
1090989389 11:131802500-131802522 GGCCTCCAGGCTCCCACAGAGGG - Intronic
1091197992 11:133747922-133747944 GGCCTCCAGGATGCCACAGATGG + Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1091856510 12:3745072-3745094 TCCCTACAGAATCCCACAGAGGG - Intronic
1093116820 12:15221609-15221631 AGCCTCCAGGCTCCCACCGAAGG + Intronic
1094000191 12:25686538-25686560 GCCTTGCAGGAGCCCACTGCGGG - Intergenic
1095518787 12:43037366-43037388 GCAAGCCAGCATCCCACTGAAGG - Intergenic
1097391088 12:59014167-59014189 GCCCTCCAGGAGTCTGCTGATGG - Intergenic
1102525644 12:113510603-113510625 GGCCACCAGAATCCCACTGGAGG - Intergenic
1103041257 12:117697311-117697333 GCCCTCCAGAAGCCCTCTGGGGG - Intronic
1103595735 12:122023260-122023282 TCCCTCCGGGACCCCAGTGAAGG - Intronic
1103951646 12:124554692-124554714 ACCTTCCACGTTCCCACTGAGGG + Intronic
1104198794 12:126567325-126567347 GCCGTGCAGGAGCCCACTGTGGG - Intergenic
1105472665 13:20706175-20706197 GCCCTGCAGGCTCCAGCTGAAGG - Intronic
1112904576 13:104401063-104401085 CCACTGCAGGATCCCACTGCAGG + Intergenic
1113095612 13:106660863-106660885 GCCCTCCACGAAGCCCCTGATGG + Intergenic
1113931016 13:113968938-113968960 GCCCTCCTGGCTCCCTCTGCTGG + Intergenic
1114671631 14:24414876-24414898 AGCCTCCATGATCCCCCTGATGG + Exonic
1118442725 14:65826933-65826955 TATCTTCAGGATCCCACTGAAGG + Intergenic
1123701067 15:22915102-22915124 TTCCCCCTGGATCCCACTGAAGG - Intronic
1125890030 15:43258907-43258929 GCCCTCCTGGATCCCATGGCAGG + Intronic
1126856645 15:52845819-52845841 GTCCTCCTGGTTCCCACTGGTGG + Intergenic
1126867011 15:52947736-52947758 GACCTCCAGGAGCCTGCTGAAGG + Intergenic
1126979567 15:54226905-54226927 GCCCTCCAGGATCCCAGACCTGG - Intronic
1131557694 15:93413938-93413960 GTCCTGCAGGCTCCCCCTGAGGG - Intergenic
1132751758 16:1460886-1460908 GCCCGTGAGGATCCCAATGAGGG + Exonic
1133283137 16:4678243-4678265 GCCCTTAAGGTCCCCACTGAGGG - Intronic
1134241769 16:12512022-12512044 GCCCTCCAGGGTCCTCCTCACGG - Intronic
1138370352 16:56521690-56521712 GCCCTCCAGGCCCCCTCTGATGG + Intergenic
1141820475 16:86442168-86442190 GCCTTCCTGGAGGCCACTGAGGG + Intergenic
1141963006 16:87421800-87421822 GGCCTCCAGGACCCCACTAAGGG + Intronic
1145786058 17:27594608-27594630 GCCCTCCAGGATCCCACTGAAGG + Intronic
1146626930 17:34441999-34442021 GCCTTCTTGGACCCCACTGAAGG - Intergenic
1146654794 17:34628842-34628864 CAGCCCCAGGATCCCACTGAGGG - Intronic
1146815308 17:35937546-35937568 GCCTTCCTGGATCCTACTCAGGG + Intronic
1148229227 17:45920783-45920805 CCCCTGCAGGATCCAACTGCTGG + Intronic
1148342384 17:46881079-46881101 GCCCACCAGGATCCTCCTGGGGG + Intronic
1149868038 17:60161496-60161518 GCCCACCAGGAGGGCACTGAGGG + Intronic
1151202640 17:72479918-72479940 GTCCTCCAGGATTCCACTCAGGG + Intergenic
1151363075 17:73600226-73600248 TCCCTCCAGGAGCCCATGGATGG + Intronic
1151532171 17:74713567-74713589 GCTCTCCAGGACCCCTCTGGTGG - Intronic
1152608076 17:81302967-81302989 GCCATCTAGGCTCCCACAGAGGG + Intergenic
1152987146 18:331256-331278 TCCCTTCAGGATCACACTGTGGG - Intronic
1156509832 18:37627037-37627059 ACCCTCCAGGATTCCACTCTTGG + Intergenic
1159260448 18:66006039-66006061 GCCCTGCAGGAGCCCACGGCAGG + Intergenic
1161444649 19:4311360-4311382 GCCCTCCCCCAACCCACTGATGG + Intronic
1161528520 19:4772585-4772607 GCCCTCCAGTATCTCTCTGGGGG - Intergenic
1165477589 19:36040123-36040145 CCCATGCAGGTTCCCACTGAAGG - Exonic
1166702024 19:44887738-44887760 GACCTCCAGTAGACCACTGAGGG - Intronic
927325950 2:21805285-21805307 GCCTTCCAGGAGCCCAGAGAAGG + Intergenic
928108612 2:28489039-28489061 GTCCTACAGGATCCCCCTGGTGG + Intronic
928398871 2:30963969-30963991 GCCCTAAAGGAGCTCACTGAAGG + Intronic
928599153 2:32886648-32886670 GCCATGCAGGAACCCACTGCAGG + Intergenic
929457215 2:42074502-42074524 CCCCTCCAGGATTCCTCTGCAGG - Intergenic
930680933 2:54255952-54255974 GCGCCCCAGGATCCCGCAGATGG - Exonic
932457275 2:71857725-71857747 ACCCTCCAGCAGCCCACTGTGGG + Intergenic
932780506 2:74555885-74555907 GCCTTCCAGGATCCCAATTCTGG + Exonic
933813443 2:86047773-86047795 TCTCCCCAGGATCCCCCTGAAGG - Intronic
934574102 2:95389698-95389720 GCCTTCCAGGAGCCCACGGAAGG + Intergenic
936427762 2:112434873-112434895 GACCTCCAAGCTCCCACTGGGGG + Intergenic
937293685 2:120797364-120797386 GGCCTCCAGGATCCCACTTTTGG - Exonic
944440965 2:199743010-199743032 GCCCTCCAGGTAACCCCTGAAGG - Intergenic
945279776 2:208025426-208025448 CCCCTCCAGGAGCGGACTGAAGG - Exonic
946432963 2:219635323-219635345 GCCATCCAGGAACTCGCTGATGG - Exonic
946481158 2:220058045-220058067 GCCATCCAAGGTCCCAGTGAAGG - Intergenic
946521960 2:220475713-220475735 TCCATCCAGGATTCAACTGATGG + Intergenic
946605442 2:221399380-221399402 GCCTTCCTGAATCCCCCTGAGGG - Intergenic
948342712 2:237268292-237268314 GTCCCCCAAGACCCCACTGAAGG - Intergenic
948389550 2:237602102-237602124 TTCCTCCAGGACCACACTGATGG + Intergenic
948613260 2:239182891-239182913 GCCCTCCAGAAGCCAACTGAGGG - Intronic
948831906 2:240602417-240602439 GCCCTCCTGGACCCCTCTGCCGG + Intronic
948947762 2:241229793-241229815 GCCCTCCTGGGTCCCAGGGAGGG - Intronic
1168864562 20:1074370-1074392 GCCCTCCTGGATCCAAATCACGG + Intergenic
1171214150 20:23340096-23340118 GCCCTCCAGGGGCCCACAGCTGG + Intergenic
1176034597 20:63030033-63030055 GCCCTTCAGGACCCCTCTGTGGG + Intergenic
1176189419 20:63800823-63800845 GCTCTGCAGGAGCCCACTGCGGG - Intronic
1176362569 21:6010206-6010228 GCCCTCCAGCATCACACCGAAGG - Intergenic
1176374482 21:6080338-6080360 GACCTCCAAGCTCCCACTGGGGG - Intergenic
1179748993 21:43457907-43457929 GACCTCCAAGCTCCCACTGGGGG + Intergenic
1179760949 21:43528339-43528361 GCCCTCCAGCATCACACCGAAGG + Intergenic
1179836291 21:44036023-44036045 GAGCTCCAGGATCCACCTGAGGG + Intronic
1180965945 22:19788046-19788068 GCCCTCCCGGATCCCACATCTGG + Exonic
1181007254 22:20019811-20019833 GCCCCACATGATCCCACTGCTGG + Intronic
1181107326 22:20582891-20582913 GCCCTCCCAGAGCCCAGTGACGG + Exonic
1182521915 22:30889615-30889637 GCTCTCCAGGATCCCCATGCCGG + Exonic
1184864107 22:47192954-47192976 GCTCTCCAGGGTCTCACAGATGG - Intergenic
949892936 3:8746562-8746584 CCCTTCCAGGGTACCACTGAGGG + Exonic
950007422 3:9700367-9700389 GCCCTCCAGGGACCCATTGGGGG + Intronic
950202520 3:11055247-11055269 GCCCTGCAGGAGCCTAATGAGGG - Intergenic
950475016 3:13209627-13209649 GCCCTCTCGGACCACACTGAAGG + Intergenic
952966736 3:38625695-38625717 GCCCCCCTGGCTCCCACTCAGGG - Intronic
954535936 3:51359244-51359266 TCCCTCCAGGCTCCCAGTGCAGG + Intronic
955876318 3:63493400-63493422 CCCTTCCAGTATCCCACTGTGGG + Intronic
956224813 3:66945720-66945742 GTCCTCAAAGATCCCACGGAGGG + Intergenic
959863581 3:111242309-111242331 GCACTGCAGGATCCCAAAGAGGG + Intronic
959930701 3:111979021-111979043 ACCCTGCAGTGTCCCACTGAGGG - Exonic
960149762 3:114238365-114238387 GCCGTACAGGAGCCCACGGAGGG + Intergenic
961298258 3:125904177-125904199 GCCTTGCAGGATCCCACAGTGGG - Intergenic
964890415 3:161527925-161527947 GAACTCTAGGATCCAACTGATGG + Intergenic
964982467 3:162702995-162703017 GCCGTGCAGGAGCCCACTGCAGG + Intergenic
966096745 3:176213491-176213513 GCCGTACAGGAGCCCACTGCGGG + Intergenic
967517546 3:190388122-190388144 GACCTCCAGGACCCCACTGTTGG + Exonic
969925711 4:10583949-10583971 TCCCTCCAGGATGCCAGTGCAGG + Intronic
971590243 4:28458297-28458319 GCTCTGCAGGATCCCAGTGCTGG - Intergenic
973008316 4:45042020-45042042 GCACTCCAAGATCCATCTGATGG - Intergenic
981031408 4:140129237-140129259 GGCTTCCATGGTCCCACTGATGG - Intronic
981146682 4:141333093-141333115 GCCGCACAGGAGCCCACTGAGGG + Intergenic
982998447 4:162381197-162381219 GGCCTCCATGATCCCAGTGGTGG + Intergenic
983181778 4:164656680-164656702 GGCCTCAGGGATCCCAGTGAGGG - Intergenic
987352248 5:17032503-17032525 GCCGTACAGGAGCCCACGGAGGG + Intergenic
988689852 5:33561237-33561259 TGACTCCAGGATCCCAGTGATGG - Intronic
991399234 5:66236176-66236198 ACCATCCAGGAACCCACTAAAGG - Intergenic
994258953 5:97634451-97634473 GTCCTACAGTATCCCACTGCTGG + Intergenic
998052875 5:139051015-139051037 TCCCTGCAGGATCCCACGTACGG - Exonic
1001587931 5:172845854-172845876 GCACCCCAGGATCCCATCGAAGG + Intronic
1005870398 6:29971033-29971055 GCCCTCCAGGGCCTCACTGCAGG + Intergenic
1006261726 6:32879783-32879805 GTCCTTCAGGATCCCCTTGAGGG + Intergenic
1007703297 6:43776660-43776682 GCCCTCCTGGAACCCACAGGTGG - Intronic
1008091026 6:47293997-47294019 GCCCTCAAGGACCCAACTCATGG + Intronic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1015726604 6:136305942-136305964 GGCCTTGAGGATTCCACTGATGG + Intergenic
1016107985 6:140186621-140186643 GGACTTCAGCATCCCACTGATGG + Intergenic
1017594880 6:156017649-156017671 GCCCTGCAGGAGCCCACTGTTGG + Intergenic
1018115360 6:160578430-160578452 ACCCTCCAGTGTACCACTGAAGG + Intronic
1018389891 6:163334215-163334237 GCCCTTGAGGATTGCACTGAGGG - Intergenic
1022779114 7:33560106-33560128 ATCCTCAAGGATCCCACTGCAGG - Intronic
1024614597 7:51100500-51100522 GCCCTCTAAGCTCTCACTGATGG + Intronic
1025985713 7:66449577-66449599 TCCCTCCAGGAGCCCAATGTGGG + Intergenic
1026002560 7:66572879-66572901 TCCCTCCAGGAGCCCAATGTGGG + Intergenic
1029705414 7:102273321-102273343 TCCCACCAGGCTCCCTCTGACGG + Intronic
1029988206 7:104940439-104940461 GCCCCCCAGGAGCCCACGGAGGG - Intergenic
1031977351 7:128102525-128102547 GCCCACCTGGTTCCCACAGAGGG + Intergenic
1032805119 7:135346419-135346441 GTTCTCCAAGATCCCACTTATGG + Intergenic
1036171517 8:6489983-6490005 GCCTTCAAGGATCACACTGTTGG + Intronic
1036260500 8:7235936-7235958 GCCGTACAGGAGCCCACAGAGGG - Intergenic
1036306113 8:7603586-7603608 GCCGTACAGGAGCCCACAGAGGG + Intergenic
1036312537 8:7694492-7694514 GCCGTACAGGAGCCCACAGAGGG - Intergenic
1036356959 8:8051571-8051593 GCCGTACAGGAGCCCACAGAGGG + Intergenic
1037547612 8:19939676-19939698 CCCCTCCTGGATCCCACTCCGGG - Intronic
1040954039 8:52961652-52961674 GCCCTGCAGGAGCCCACAGCAGG - Intergenic
1041008477 8:53518634-53518656 GCTCTCCAGGAGCCCACCAAGGG - Intergenic
1048619040 8:136111185-136111207 GCCCTCAAGGAACTCACTCATGG - Intergenic
1049545413 8:143228508-143228530 TCCCTCCATGATCCCACCCAGGG - Intergenic
1051372635 9:16371370-16371392 GCCCTCCATGAAGCCTCTGAGGG - Intergenic
1058174830 9:101724190-101724212 GCCGCACAGGAGCCCACTGAGGG + Intronic
1060235228 9:121857963-121857985 GTCATCCAGGATCCCACGGAGGG - Intronic
1061892142 9:133628059-133628081 GCTCTCAAGTATCCCACTGCAGG - Intergenic
1186295615 X:8145047-8145069 GCCACACAGGAGCCCACTGAGGG + Intergenic
1187482494 X:19670709-19670731 GCCAGCTAGGATCCCACAGAGGG - Intronic
1190512424 X:51186414-51186436 AGCCTCCAGGATTGCACTGAGGG - Intergenic
1194981954 X:100450156-100450178 GCCCTCCTGGTTCCCAGTGGTGG - Intergenic