ID: 1145791455

View in Genome Browser
Species Human (GRCh38)
Location 17:27630234-27630256
Sequence CATCTAGGTGGAGCACAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145791450_1145791455 26 Left 1145791450 17:27630185-27630207 CCTCAGTCTATTGGAGCATCTCA 0: 1
1: 1
2: 2
3: 6
4: 99
Right 1145791455 17:27630234-27630256 CATCTAGGTGGAGCACAGGAAGG 0: 1
1: 0
2: 2
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145791455 Original CRISPR CATCTAGGTGGAGCACAGGA AGG Exonic
900598689 1:3493927-3493949 CGTCTGGGTGCAGGACAGGAGGG - Intronic
907941622 1:59093696-59093718 CATCTACAGGGAACACAGGAAGG + Intergenic
908440534 1:64149517-64149539 CATCTAAGAGGAGCACAGTAGGG - Intronic
912204113 1:107491960-107491982 CATTTAGCTGGAGCACAGGCTGG - Intergenic
915858308 1:159414280-159414302 CATCGAGGTAGAGAACAGAACGG - Intergenic
915932064 1:160067039-160067061 CAACAAGGTGCAGCACAGAAAGG - Intronic
915950475 1:160186892-160186914 CATCTAGCTGGAGCCCCGCAGGG + Exonic
916006475 1:160665700-160665722 AATCTTGGTGGAGGACAGGAAGG - Intergenic
917200954 1:172514822-172514844 CATCTGGGTGGTGCACTTGATGG - Intergenic
919700873 1:200629836-200629858 CCTCCAGGTGGAGGAGAGGATGG + Intronic
922423967 1:225477273-225477295 CATTTAGTTGGAACATAGGAGGG - Intergenic
1063161305 10:3420829-3420851 GATGTAGGTGGGGCACAGGTAGG + Intergenic
1063670405 10:8095492-8095514 CATCTACGGGGAGAACAGCAGGG + Intergenic
1064297366 10:14090490-14090512 CACCTGAGTGAAGCACAGGAAGG + Intronic
1067355535 10:45521824-45521846 CATCTAGGTGAAGGACAGACAGG - Intronic
1071713017 10:88068163-88068185 CATTTAAGTGGAGGCCAGGAAGG + Intergenic
1072474121 10:95742411-95742433 ACTCTAGGGGGAGGACAGGAAGG - Intronic
1074403045 10:113157621-113157643 CATCTTTGAGGAGCACATGAAGG - Intronic
1076687282 10:132203884-132203906 GATGTAGGTTGCGCACAGGAGGG - Exonic
1077909990 11:6565116-6565138 CATCTGGGTGGAGTATTGGAAGG + Intronic
1078068844 11:8095448-8095470 CATCCAGGAGGAGGAGAGGAGGG - Intronic
1078847688 11:15135334-15135356 CATCTATCTGGGGCACAGAATGG - Intronic
1081596680 11:44464104-44464126 CATCTTGGTGGAGGAATGGAAGG - Intergenic
1086070310 11:82792334-82792356 TTTCTAGGTGGATCAGAGGAAGG - Intergenic
1086137338 11:83455310-83455332 CACCGAGCTGTAGCACAGGATGG - Intronic
1087647202 11:100822001-100822023 CATTTATCTGGACCACAGGATGG - Intronic
1088296755 11:108306233-108306255 AATCTAGTAGGATCACAGGATGG - Intronic
1089959176 11:122600576-122600598 GATCTAGCTGGAGCCCAGGAAGG + Intergenic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1091013353 11:132026384-132026406 CATATAAGTGGACCCCAGGATGG - Intronic
1091232035 11:133994423-133994445 CATTTAGGTGCTGCACAGTATGG - Intergenic
1093277335 12:17146503-17146525 CACCCAGGTGGGGCACAGAAAGG + Intergenic
1096492501 12:52020462-52020484 CATCTAAGGGGAGCATAGGGGGG + Intergenic
1098410409 12:70176514-70176536 CATAAAGGTGGAGCCCTGGAAGG + Intergenic
1100321324 12:93495780-93495802 TATCTAGGTGGGTCACAGGTGGG - Intronic
1100676749 12:96877060-96877082 CATCTGCGTGTAGCAGAGGAAGG - Intergenic
1102923296 12:116808829-116808851 GAGCCAGGGGGAGCACAGGACGG - Intronic
1104477342 12:129081691-129081713 CCTCTAGGTAGAGCAGAGGTGGG + Intronic
1106026471 13:25960249-25960271 CGTCCAGCTGGAGCAGAGGATGG + Intronic
1106197637 13:27508009-27508031 CATCAAGCTGGAGTAAAGGATGG + Intergenic
1106492320 13:30237819-30237841 CATAAATGTGGAGCTCAGGAAGG - Intronic
1106674613 13:31945269-31945291 CTGCCAGCTGGAGCACAGGATGG + Intergenic
1109759645 13:66811361-66811383 CATATACCTGGTGCACAGGAAGG - Intronic
1112260350 13:97872576-97872598 CATATAGGGGAATCACAGGATGG + Intergenic
1113651183 13:112035321-112035343 CCTCTGGGTGGGGGACAGGAGGG - Intergenic
1113651195 13:112035355-112035377 CCTCTAGGTTGGGGACAGGAGGG - Intergenic
1113651204 13:112035389-112035411 CCTCTGGGTGGGGGACAGGAGGG - Intergenic
1113651217 13:112035423-112035445 CCTCTAGGTTGGGGACAGGAGGG - Intergenic
1113651263 13:112035560-112035582 CCTCTAGGTTGGGGACAGGAGGG - Intergenic
1113886632 13:113664238-113664260 CATCTGTGAGCAGCACAGGAGGG + Intergenic
1114224437 14:20725028-20725050 CAGCTAGTTGGGGGACAGGAAGG + Intergenic
1117420893 14:55543806-55543828 CACCTTGGTGGAGAACAAGAAGG + Intergenic
1117834683 14:59791433-59791455 CACCCAGGTGCAGCACAGAAAGG - Intronic
1119635262 14:76268170-76268192 CCTCTAAGACGAGCACAGGAAGG - Intergenic
1122072532 14:99213915-99213937 CCTCTCGGAGGAGCACCGGAGGG - Intronic
1123465597 15:20512599-20512621 CACCTAGATGAAGCGCAGGAAGG + Intergenic
1123652519 15:22488438-22488460 CACCTAGATGAAGCGCAGGAAGG - Intergenic
1123742941 15:23297297-23297319 CACCTAGATGAAGCGCAGGAAGG - Intergenic
1124276319 15:28328578-28328600 CACCTAGATGAAGCGCAGGAAGG + Intergenic
1126525805 15:49652747-49652769 GATCTATGTGGAGCAAAGGGTGG + Exonic
1127442384 15:59022809-59022831 CCTCTAGGTAGAGAGCAGGAAGG - Intronic
1128222738 15:65980739-65980761 GATCTGGGTGGGGCACTGGAGGG - Intronic
1128396038 15:67226847-67226869 TATCTGGGTGGAGGGCAGGAAGG + Intronic
1133067902 16:3222751-3222773 CTTCTAGGCAGAGGACAGGAAGG + Exonic
1137052015 16:35722439-35722461 CATCTCTGTGGAGCACAGGCTGG - Intergenic
1138146426 16:54616357-54616379 CATCCAGGCAGAGCACTGGACGG - Intergenic
1138779607 16:59767106-59767128 AAAATAGGTAGAGCACAGGAAGG - Intergenic
1140809834 16:78566511-78566533 CATCCATGTGAGGCACAGGATGG + Intronic
1140939507 16:79708198-79708220 CATCAAGGTGGCACACAGGTGGG - Intergenic
1141231781 16:82174238-82174260 AATCTGGGGTGAGCACAGGAAGG + Intergenic
1142264492 16:89057528-89057550 CACCTGGGAGGAGGACAGGAAGG - Intergenic
1142264520 16:89057618-89057640 CACCTGGGAGGAGGACAGGAAGG - Intergenic
1143121095 17:4607385-4607407 CATCGAAGTGGAGGACATGATGG + Exonic
1143933413 17:10456037-10456059 CATATAAGTGGAGCACAGGTAGG + Intronic
1144070777 17:11669486-11669508 CCTCTATGTGGAGGACCGGAAGG + Exonic
1144887795 17:18475774-18475796 CATCTAGGCAGAACACAGGAAGG + Intergenic
1145144417 17:20468526-20468548 CATCTAGGCAGAACACAGGAAGG - Intergenic
1145175862 17:20699929-20699951 CATCTAGGCAGAGCACAGGAAGG - Intergenic
1145791455 17:27630234-27630256 CATCTAGGTGGAGCACAGGAAGG + Exonic
1146643732 17:34562530-34562552 CATGTAGGTGGGGAACAGGTGGG + Intergenic
1147308519 17:39579806-39579828 CATGTAGGGGGACCAGAGGAAGG - Intergenic
1147648671 17:42049746-42049768 CAGGTAGGTAGAGCCCAGGAAGG + Intronic
1148215858 17:45833746-45833768 CATGTAGGTGATGCCCAGGAGGG - Exonic
1148889934 17:50800136-50800158 AATGTTGGTGGAGCAAAGGAGGG - Intergenic
1149600913 17:57892442-57892464 CCTCTGGGTGGGACACAGGAAGG - Intronic
1150668922 17:67172231-67172253 CATCTTAGTGGAGAAAAGGAGGG - Intronic
1154144260 18:11853762-11853784 CAACCATGTGGAGGACAGGAGGG - Exonic
1156858578 18:41811579-41811601 TATCTATGTGGAGCAGAGGCTGG + Intergenic
1157379924 18:47204636-47204658 AATTTAGGTGGAGAACTGGAAGG + Intergenic
1158629601 18:59100397-59100419 CATCTTGGCGGAGTCCAGGAAGG + Intergenic
1158702647 18:59762631-59762653 CATGTAGGAAGAGCAAAGGATGG - Intergenic
1159860134 18:73638628-73638650 CATCCAGTTTGAGCACAGAAAGG + Intergenic
1162128198 19:8510762-8510784 GATCTGGGTGGGGCAGAGGAGGG + Exonic
1162227197 19:9232944-9232966 CATGTAGAAAGAGCACAGGATGG + Intergenic
1165125724 19:33595697-33595719 CATTTAGGTGGAGCTCAGCTGGG + Intergenic
1165145299 19:33726612-33726634 CCTCTGGGTGGCTCACAGGATGG + Intronic
1166719662 19:44989825-44989847 CATCTAGGCGGAGCACTGGAAGG + Intronic
1166822909 19:45591528-45591550 CACCGAGATGCAGCACAGGAAGG + Exonic
1167528049 19:49997567-49997589 CATCCTGGTGGGGGACAGGAGGG + Exonic
1168633752 19:57977884-57977906 CATCAAGCTGGAGTACTGGATGG - Exonic
925268838 2:2587779-2587801 TATCTAGCTGGAGCCCAGGCAGG - Intergenic
928357765 2:30635982-30636004 CATCTAGTAAGGGCACAGGATGG + Intronic
932219633 2:69989721-69989743 CACCTGGGTGGGGCCCAGGAAGG - Intergenic
935114752 2:100125810-100125832 CAGCTGGCTGGAGCACAGCAGGG + Intronic
935659857 2:105457059-105457081 CATTTGGGTGGAGGAGAGGATGG + Intergenic
937668641 2:124515708-124515730 CGTATAGGTGGAGCAGAGGCTGG + Intronic
938182573 2:129196394-129196416 CATCTCTGGGGAGCACAGAATGG - Intergenic
940468234 2:154060095-154060117 CATATAGGTGGAGGGCAGCAAGG - Intronic
1170040875 20:12038019-12038041 CAGCTGGCTGGAGCACAGTAAGG + Intergenic
1170983529 20:21237730-21237752 TAGCTAGGGGGACCACAGGAAGG - Intronic
1173854837 20:46243460-46243482 CTTCTCAGTGGAGCCCAGGACGG - Intronic
1173945075 20:46944089-46944111 CATCCAGGGGGAGCAGAGCAGGG - Intronic
1175308391 20:57993901-57993923 CGTCTCGCTGGAGAACAGGAGGG + Intergenic
1176894730 21:14363260-14363282 AATCTAGGTACAGCCCAGGATGG - Intergenic
1176896298 21:14382983-14383005 GATCTAGCTGGAGCAGCGGAAGG - Intronic
1178283571 21:31305977-31305999 AATCCAGGCAGAGCACAGGATGG + Intronic
1178643803 21:34367859-34367881 CAGCTAGAAGGAGCACAGGCAGG - Intronic
1181520873 22:23448631-23448653 CAGCCAGGTGGGGCTCAGGAGGG + Intergenic
1182998000 22:34832052-34832074 CATCCAGGCAGAGCAGAGGAAGG + Intergenic
1184307861 22:43619199-43619221 CTTCTAGGTGGTGCACACGTGGG + Intronic
1185282440 22:49979779-49979801 CCACTAGGTGGTGCACACGAAGG + Intergenic
966752253 3:183333481-183333503 CATCTAGGTGGAGATCCAGAAGG + Intronic
968400813 4:295483-295505 CATCTATCTGGAGCAAAGAAAGG - Exonic
975461397 4:74657623-74657645 CAGCAAGGTGGGCCACAGGATGG - Intergenic
975612932 4:76219205-76219227 CATCCAGGAGGGGCACAGGTTGG + Intronic
976407823 4:84679531-84679553 CATCTAGCTGCAGCACAGCAGGG - Intronic
977773075 4:100882308-100882330 CTTCTGGGTAGACCACAGGAAGG + Intergenic
978472692 4:109087387-109087409 CATCTAGGTGTGGCGCAGGCGGG - Intronic
980963941 4:139502517-139502539 GGTGTGGGTGGAGCACAGGAAGG + Intronic
983248255 4:165313762-165313784 CATGTAGGTGAAACACAGGGAGG - Intronic
984262444 4:177458166-177458188 CAACTTTGTGGAGCACAGAAAGG + Intergenic
984562909 4:181291921-181291943 CATCTATCTGGGGAACAGGAGGG + Intergenic
984926062 4:184808029-184808051 CATTTAGGTGGACCTCAGGAGGG - Intronic
985310183 4:188589123-188589145 CATCTAGGAGGTGTACACGAAGG - Intergenic
986331625 5:6720499-6720521 CATCTGAGTGCAGCACAGAAAGG - Intronic
986434804 5:7718653-7718675 CACCTACTTGTAGCACAGGAAGG - Intronic
987250520 5:16095863-16095885 CAGCTCTGTGGTGCACAGGAGGG - Intronic
993296181 5:86144125-86144147 CATCTGGCTGGAGCCCAGGCAGG + Intergenic
993730857 5:91421070-91421092 CAACTCGGTGGGGCACAGCATGG + Intergenic
996240970 5:121200966-121200988 CATCTAGTTGGACCACATGTAGG + Intergenic
996641652 5:125761930-125761952 CAGCTAGGTGGGGCTCAGTAGGG - Intergenic
997646626 5:135486413-135486435 CATCTTGGTGGGTCAAAGGAAGG + Intergenic
998502057 5:142642117-142642139 CTTCTAGGAGGAGCACAATAGGG + Intronic
999140500 5:149358222-149358244 CAGCTAGGTGGGGTATAGGAGGG + Intronic
1000393578 5:160749787-160749809 CATGTGTGTGGATCACAGGAGGG + Intronic
1000909515 5:167005300-167005322 CATCTATGTGGTACACAGGTGGG - Intergenic
1001555088 5:172631704-172631726 CATCTAGGGGGACCTCAGGCAGG - Intergenic
1001565975 5:172699752-172699774 CCTCCAGGTGGAGAAGAGGAAGG + Intergenic
1004141866 6:13025491-13025513 CATCTAAATGGAGGACAGCAGGG - Intronic
1005773123 6:29097556-29097578 TATCTAGGTGCTCCACAGGAAGG + Intergenic
1006942906 6:37764780-37764802 TATCTGGGCGGAGCACTGGATGG - Intergenic
1007213458 6:40216791-40216813 GATATGGGTGGACCACAGGAGGG + Intergenic
1009278590 6:61718509-61718531 CCTCTAGGGAGAGAACAGGATGG - Intronic
1010073444 6:71771879-71771901 CAGCTAGTTGGAACACAGCACGG + Intergenic
1011075301 6:83431530-83431552 CACCTAGGGGGATTACAGGACGG + Intergenic
1012487773 6:99741669-99741691 CTTTTATGTGGAGCACAGCAAGG + Intergenic
1017908226 6:158771284-158771306 CATCGAGGTGCAGCAGATGAAGG - Exonic
1021196460 7:17679706-17679728 CATCCAGTTGGGGCGCAGGAGGG + Intergenic
1022071719 7:26922544-26922566 CACCTTGGTGGAGAACAAGAAGG + Intronic
1022466415 7:30655661-30655683 CATGTAGGTGATGCCCAGGAGGG + Exonic
1023965860 7:44962804-44962826 CATCTCCGTGGAGCCCAGGCCGG - Exonic
1031889922 7:127282118-127282140 TATCTAGGAGGAGAACAGGATGG - Intergenic
1032394154 7:131576946-131576968 CATCTGCATTGAGCACAGGAAGG + Intergenic
1032888273 7:136165457-136165479 TAACTAGGTGGCCCACAGGATGG + Intergenic
1048760624 8:137790549-137790571 CATAGAGTTAGAGCACAGGAGGG + Intergenic
1048799896 8:138185952-138185974 CACCTAGGTGGAGCTCAGGTGGG - Intronic
1049236034 8:141512894-141512916 CACCTGGCCGGAGCACAGGAAGG + Intergenic
1049435586 8:142584714-142584736 CATCTGGGTGGGACACAGGGTGG + Intergenic
1050334038 9:4573778-4573800 ACACTTGGTGGAGCACAGGATGG - Intronic
1051354733 9:16231304-16231326 CCTCCAGGTGGGGCACAGGAAGG - Intronic
1052890411 9:33694299-33694321 CATCCAGGAGGAGCACATAAGGG - Intergenic
1053250098 9:36567156-36567178 CAGTTGGGTGGAGCACAGGATGG - Intergenic
1059406140 9:114099099-114099121 CATCCAGGTGGTGCTCAGGTGGG - Intronic
1061324328 9:129853808-129853830 AAGAGAGGTGGAGCACAGGAAGG + Intronic
1061518487 9:131103345-131103367 CATCACGGAGGAGCACAGCATGG + Intronic
1189164418 X:38846569-38846591 CATCTGTATGGAGCAGAGGAAGG + Intergenic
1189246844 X:39569899-39569921 CATCTAGCTGCAGCACAGCCTGG + Intergenic
1190784022 X:53625975-53625997 CATCTCTATGGAGCACAGGCTGG - Intronic
1196384055 X:115128750-115128772 CATCTAGCTGGAGCAGGGGCTGG - Intronic
1199202392 X:145107737-145107759 CATGTGGGTGGAGTGCAGGAAGG + Intergenic