ID: 1145796071

View in Genome Browser
Species Human (GRCh38)
Location 17:27655953-27655975
Sequence CAGCTGGTACAGTTTGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145796071_1145796082 28 Left 1145796071 17:27655953-27655975 CCATGTGCAAACTGTACCAGCTG No data
Right 1145796082 17:27656004-27656026 GCCCCCACTCAGGCACTCTCAGG No data
1145796071_1145796073 -6 Left 1145796071 17:27655953-27655975 CCATGTGCAAACTGTACCAGCTG No data
Right 1145796073 17:27655970-27655992 CAGCTGCTCCGCCCACACCACGG No data
1145796071_1145796075 3 Left 1145796071 17:27655953-27655975 CCATGTGCAAACTGTACCAGCTG No data
Right 1145796075 17:27655979-27656001 CGCCCACACCACGGCCTCCTTGG No data
1145796071_1145796080 18 Left 1145796071 17:27655953-27655975 CCATGTGCAAACTGTACCAGCTG No data
Right 1145796080 17:27655994-27656016 CTCCTTGGACGCCCCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145796071 Original CRISPR CAGCTGGTACAGTTTGCACA TGG (reversed) Intergenic
No off target data available for this crispr