ID: 1145796075

View in Genome Browser
Species Human (GRCh38)
Location 17:27655979-27656001
Sequence CGCCCACACCACGGCCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145796071_1145796075 3 Left 1145796071 17:27655953-27655975 CCATGTGCAAACTGTACCAGCTG No data
Right 1145796075 17:27655979-27656001 CGCCCACACCACGGCCTCCTTGG No data
1145796067_1145796075 13 Left 1145796067 17:27655943-27655965 CCCCTACTGCCCATGTGCAAACT No data
Right 1145796075 17:27655979-27656001 CGCCCACACCACGGCCTCCTTGG No data
1145796070_1145796075 4 Left 1145796070 17:27655952-27655974 CCCATGTGCAAACTGTACCAGCT No data
Right 1145796075 17:27655979-27656001 CGCCCACACCACGGCCTCCTTGG No data
1145796068_1145796075 12 Left 1145796068 17:27655944-27655966 CCCTACTGCCCATGTGCAAACTG No data
Right 1145796075 17:27655979-27656001 CGCCCACACCACGGCCTCCTTGG No data
1145796069_1145796075 11 Left 1145796069 17:27655945-27655967 CCTACTGCCCATGTGCAAACTGT No data
Right 1145796075 17:27655979-27656001 CGCCCACACCACGGCCTCCTTGG No data
1145796066_1145796075 20 Left 1145796066 17:27655936-27655958 CCAATGTCCCCTACTGCCCATGT No data
Right 1145796075 17:27655979-27656001 CGCCCACACCACGGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145796075 Original CRISPR CGCCCACACCACGGCCTCCT TGG Intergenic
No off target data available for this crispr