ID: 1145797683

View in Genome Browser
Species Human (GRCh38)
Location 17:27665508-27665530
Sequence GACTCCCAAATGCCCTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145797677_1145797683 16 Left 1145797677 17:27665469-27665491 CCGGCAAATGACCTGAGTGACCC No data
Right 1145797683 17:27665508-27665530 GACTCCCAAATGCCCTCTGTAGG No data
1145797679_1145797683 5 Left 1145797679 17:27665480-27665502 CCTGAGTGACCCAGATGGCCTGA No data
Right 1145797683 17:27665508-27665530 GACTCCCAAATGCCCTCTGTAGG No data
1145797681_1145797683 -5 Left 1145797681 17:27665490-27665512 CCAGATGGCCTGAGCACTGACTC No data
Right 1145797683 17:27665508-27665530 GACTCCCAAATGCCCTCTGTAGG No data
1145797680_1145797683 -4 Left 1145797680 17:27665489-27665511 CCCAGATGGCCTGAGCACTGACT No data
Right 1145797683 17:27665508-27665530 GACTCCCAAATGCCCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145797683 Original CRISPR GACTCCCAAATGCCCTCTGT AGG Intergenic
No off target data available for this crispr