ID: 1145798192

View in Genome Browser
Species Human (GRCh38)
Location 17:27667880-27667902
Sequence GGTGGTGCTGGATACTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145798180_1145798192 10 Left 1145798180 17:27667847-27667869 CCCACACCCCATGGCCACTTCAG No data
Right 1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG No data
1145798183_1145798192 3 Left 1145798183 17:27667854-27667876 CCCATGGCCACTTCAGTCTCCCA No data
Right 1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG No data
1145798177_1145798192 28 Left 1145798177 17:27667829-27667851 CCCTGGGAGAGGTCAGAGCCCAC No data
Right 1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG No data
1145798181_1145798192 9 Left 1145798181 17:27667848-27667870 CCACACCCCATGGCCACTTCAGT No data
Right 1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG No data
1145798178_1145798192 27 Left 1145798178 17:27667830-27667852 CCTGGGAGAGGTCAGAGCCCACA No data
Right 1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG No data
1145798182_1145798192 4 Left 1145798182 17:27667853-27667875 CCCCATGGCCACTTCAGTCTCCC No data
Right 1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG No data
1145798184_1145798192 2 Left 1145798184 17:27667855-27667877 CCATGGCCACTTCAGTCTCCCAC No data
Right 1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG No data
1145798187_1145798192 -4 Left 1145798187 17:27667861-27667883 CCACTTCAGTCTCCCACTGGGTG No data
Right 1145798192 17:27667880-27667902 GGTGGTGCTGGATACTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145798192 Original CRISPR GGTGGTGCTGGATACTTTCA TGG Intergenic
No off target data available for this crispr