ID: 1145798401

View in Genome Browser
Species Human (GRCh38)
Location 17:27668739-27668761
Sequence GATGAAGGAGTCACTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145798401_1145798404 -8 Left 1145798401 17:27668739-27668761 CCTCCTGGAGTGACTCCTTCATC No data
Right 1145798404 17:27668754-27668776 CCTTCATCCTCCAAGTCTCCAGG No data
1145798401_1145798406 -4 Left 1145798401 17:27668739-27668761 CCTCCTGGAGTGACTCCTTCATC No data
Right 1145798406 17:27668758-27668780 CATCCTCCAAGTCTCCAGGGTGG No data
1145798401_1145798405 -7 Left 1145798401 17:27668739-27668761 CCTCCTGGAGTGACTCCTTCATC No data
Right 1145798405 17:27668755-27668777 CTTCATCCTCCAAGTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145798401 Original CRISPR GATGAAGGAGTCACTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr