ID: 1145798542

View in Genome Browser
Species Human (GRCh38)
Location 17:27669476-27669498
Sequence CCTCCCAAGTTCCAAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145798542_1145798552 25 Left 1145798542 17:27669476-27669498 CCCAGGGCTTGGAACTTGGGAGG No data
Right 1145798552 17:27669524-27669546 CCCTGGTACAGGAGAGCTCTTGG No data
1145798542_1145798548 8 Left 1145798542 17:27669476-27669498 CCCAGGGCTTGGAACTTGGGAGG No data
Right 1145798548 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG No data
1145798542_1145798549 14 Left 1145798542 17:27669476-27669498 CCCAGGGCTTGGAACTTGGGAGG No data
Right 1145798549 17:27669513-27669535 TACCAGCTGCTCCCTGGTACAGG No data
1145798542_1145798546 -9 Left 1145798542 17:27669476-27669498 CCCAGGGCTTGGAACTTGGGAGG No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145798542 Original CRISPR CCTCCCAAGTTCCAAGCCCT GGG (reversed) Intergenic
No off target data available for this crispr