ID: 1145798546

View in Genome Browser
Species Human (GRCh38)
Location 17:27669490-27669512
Sequence CTTGGGAGGTGCTCGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145798531_1145798546 23 Left 1145798531 17:27669444-27669466 CCTGGGTTCTGGCCCCACGTGTT No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data
1145798542_1145798546 -9 Left 1145798542 17:27669476-27669498 CCCAGGGCTTGGAACTTGGGAGG No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data
1145798530_1145798546 26 Left 1145798530 17:27669441-27669463 CCTCCTGGGTTCTGGCCCCACGT No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data
1145798539_1145798546 0 Left 1145798539 17:27669467-27669489 CCAGTCTGGCCCAGGGCTTGGAA No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data
1145798533_1145798546 11 Left 1145798533 17:27669456-27669478 CCCCACGTGTTCCAGTCTGGCCC No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data
1145798534_1145798546 10 Left 1145798534 17:27669457-27669479 CCCACGTGTTCCAGTCTGGCCCA No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data
1145798544_1145798546 -10 Left 1145798544 17:27669477-27669499 CCAGGGCTTGGAACTTGGGAGGT No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data
1145798535_1145798546 9 Left 1145798535 17:27669458-27669480 CCACGTGTTCCAGTCTGGCCCAG No data
Right 1145798546 17:27669490-27669512 CTTGGGAGGTGCTCGGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145798546 Original CRISPR CTTGGGAGGTGCTCGGTCCA TGG Intergenic
No off target data available for this crispr