ID: 1145798548

View in Genome Browser
Species Human (GRCh38)
Location 17:27669507-27669529
Sequence CCATGGTACCAGCTGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145798534_1145798548 27 Left 1145798534 17:27669457-27669479 CCCACGTGTTCCAGTCTGGCCCA No data
Right 1145798548 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG No data
1145798544_1145798548 7 Left 1145798544 17:27669477-27669499 CCAGGGCTTGGAACTTGGGAGGT No data
Right 1145798548 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG No data
1145798535_1145798548 26 Left 1145798535 17:27669458-27669480 CCACGTGTTCCAGTCTGGCCCAG No data
Right 1145798548 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG No data
1145798533_1145798548 28 Left 1145798533 17:27669456-27669478 CCCCACGTGTTCCAGTCTGGCCC No data
Right 1145798548 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG No data
1145798542_1145798548 8 Left 1145798542 17:27669476-27669498 CCCAGGGCTTGGAACTTGGGAGG No data
Right 1145798548 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG No data
1145798539_1145798548 17 Left 1145798539 17:27669467-27669489 CCAGTCTGGCCCAGGGCTTGGAA No data
Right 1145798548 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145798548 Original CRISPR CCATGGTACCAGCTGCTCCC TGG Intergenic
No off target data available for this crispr