ID: 1145798549

View in Genome Browser
Species Human (GRCh38)
Location 17:27669513-27669535
Sequence TACCAGCTGCTCCCTGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145798544_1145798549 13 Left 1145798544 17:27669477-27669499 CCAGGGCTTGGAACTTGGGAGGT No data
Right 1145798549 17:27669513-27669535 TACCAGCTGCTCCCTGGTACAGG No data
1145798539_1145798549 23 Left 1145798539 17:27669467-27669489 CCAGTCTGGCCCAGGGCTTGGAA No data
Right 1145798549 17:27669513-27669535 TACCAGCTGCTCCCTGGTACAGG No data
1145798542_1145798549 14 Left 1145798542 17:27669476-27669498 CCCAGGGCTTGGAACTTGGGAGG No data
Right 1145798549 17:27669513-27669535 TACCAGCTGCTCCCTGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145798549 Original CRISPR TACCAGCTGCTCCCTGGTAC AGG Intergenic
No off target data available for this crispr