ID: 1145798552

View in Genome Browser
Species Human (GRCh38)
Location 17:27669524-27669546
Sequence CCCTGGTACAGGAGAGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145798547_1145798552 -6 Left 1145798547 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG No data
Right 1145798552 17:27669524-27669546 CCCTGGTACAGGAGAGCTCTTGG No data
1145798542_1145798552 25 Left 1145798542 17:27669476-27669498 CCCAGGGCTTGGAACTTGGGAGG No data
Right 1145798552 17:27669524-27669546 CCCTGGTACAGGAGAGCTCTTGG No data
1145798544_1145798552 24 Left 1145798544 17:27669477-27669499 CCAGGGCTTGGAACTTGGGAGGT No data
Right 1145798552 17:27669524-27669546 CCCTGGTACAGGAGAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145798552 Original CRISPR CCCTGGTACAGGAGAGCTCT TGG Intergenic
No off target data available for this crispr