ID: 1145799100

View in Genome Browser
Species Human (GRCh38)
Location 17:27672043-27672065
Sequence CACTGTCCCCATGGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145799100_1145799112 2 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799112 17:27672068-27672090 GGCTGTAGCTCTAGGGAAATGGG No data
1145799100_1145799116 13 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799116 17:27672079-27672101 TAGGGAAATGGGGGTGAACAGGG No data
1145799100_1145799115 12 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799115 17:27672078-27672100 CTAGGGAAATGGGGGTGAACAGG No data
1145799100_1145799111 1 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799111 17:27672067-27672089 GGGCTGTAGCTCTAGGGAAATGG No data
1145799100_1145799118 18 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799118 17:27672084-27672106 AAATGGGGGTGAACAGGGGAAGG No data
1145799100_1145799114 4 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799114 17:27672070-27672092 CTGTAGCTCTAGGGAAATGGGGG No data
1145799100_1145799119 21 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799119 17:27672087-27672109 TGGGGGTGAACAGGGGAAGGTGG No data
1145799100_1145799117 14 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799117 17:27672080-27672102 AGGGAAATGGGGGTGAACAGGGG No data
1145799100_1145799120 22 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799120 17:27672088-27672110 GGGGGTGAACAGGGGAAGGTGGG No data
1145799100_1145799109 -6 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799109 17:27672060-27672082 ACAGTGAGGGCTGTAGCTCTAGG No data
1145799100_1145799110 -5 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799110 17:27672061-27672083 CAGTGAGGGCTGTAGCTCTAGGG No data
1145799100_1145799113 3 Left 1145799100 17:27672043-27672065 CCCCCTTCCCCATGGGGACAGTG No data
Right 1145799113 17:27672069-27672091 GCTGTAGCTCTAGGGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145799100 Original CRISPR CACTGTCCCCATGGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr