ID: 1145801626

View in Genome Browser
Species Human (GRCh38)
Location 17:27689882-27689904
Sequence GTGTCTGTCTTTATTTGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145801619_1145801626 26 Left 1145801619 17:27689833-27689855 CCATTGTTGCATAAATAAATCAA 0: 5
1: 7
2: 8
3: 44
4: 462
Right 1145801626 17:27689882-27689904 GTGTCTGTCTTTATTTGATATGG No data
1145801618_1145801626 27 Left 1145801618 17:27689832-27689854 CCCATTGTTGCATAAATAAATCA 0: 4
1: 7
2: 8
3: 31
4: 367
Right 1145801626 17:27689882-27689904 GTGTCTGTCTTTATTTGATATGG No data
1145801617_1145801626 28 Left 1145801617 17:27689831-27689853 CCCCATTGTTGCATAAATAAATC 0: 6
1: 6
2: 7
3: 26
4: 257
Right 1145801626 17:27689882-27689904 GTGTCTGTCTTTATTTGATATGG No data
1145801623_1145801626 0 Left 1145801623 17:27689859-27689881 CCTTACTAACATATCCAGGGGTG No data
Right 1145801626 17:27689882-27689904 GTGTCTGTCTTTATTTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145801626 Original CRISPR GTGTCTGTCTTTATTTGATA TGG Intergenic
No off target data available for this crispr