ID: 1145803237

View in Genome Browser
Species Human (GRCh38)
Location 17:27705195-27705217
Sequence TGATTCCCACACATTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145803237_1145803240 20 Left 1145803237 17:27705195-27705217 CCACACACAATGTGTGGGAATCA No data
Right 1145803240 17:27705238-27705260 ATAAGTTGCTTTTTGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145803237 Original CRISPR TGATTCCCACACATTGTGTG TGG (reversed) Intergenic
No off target data available for this crispr