ID: 1145803240

View in Genome Browser
Species Human (GRCh38)
Location 17:27705238-27705260
Sequence ATAAGTTGCTTTTTGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145803234_1145803240 23 Left 1145803234 17:27705192-27705214 CCCCCACACACAATGTGTGGGAA No data
Right 1145803240 17:27705238-27705260 ATAAGTTGCTTTTTGAAAAATGG No data
1145803236_1145803240 21 Left 1145803236 17:27705194-27705216 CCCACACACAATGTGTGGGAATC No data
Right 1145803240 17:27705238-27705260 ATAAGTTGCTTTTTGAAAAATGG No data
1145803233_1145803240 24 Left 1145803233 17:27705191-27705213 CCCCCCACACACAATGTGTGGGA No data
Right 1145803240 17:27705238-27705260 ATAAGTTGCTTTTTGAAAAATGG No data
1145803237_1145803240 20 Left 1145803237 17:27705195-27705217 CCACACACAATGTGTGGGAATCA No data
Right 1145803240 17:27705238-27705260 ATAAGTTGCTTTTTGAAAAATGG No data
1145803235_1145803240 22 Left 1145803235 17:27705193-27705215 CCCCACACACAATGTGTGGGAAT No data
Right 1145803240 17:27705238-27705260 ATAAGTTGCTTTTTGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145803240 Original CRISPR ATAAGTTGCTTTTTGAAAAA TGG Intergenic
No off target data available for this crispr