ID: 1145810521

View in Genome Browser
Species Human (GRCh38)
Location 17:27761272-27761294
Sequence CAGCTGGTACAGTTTGCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 3, 1: 1, 2: 0, 3: 9, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145810521_1145810525 4 Left 1145810521 17:27761272-27761294 CCATGCGCAAACTGTACCAGCTG 0: 3
1: 1
2: 0
3: 9
4: 78
Right 1145810525 17:27761299-27761321 GCCCACACCACGGCCCTCCTTGG 0: 1
1: 0
2: 4
3: 21
4: 253
1145810521_1145810523 -6 Left 1145810521 17:27761272-27761294 CCATGCGCAAACTGTACCAGCTG 0: 3
1: 1
2: 0
3: 9
4: 78
Right 1145810523 17:27761289-27761311 CAGCTGCTCCGCCCACACCACGG 0: 4
1: 0
2: 0
3: 26
4: 263
1145810521_1145810531 19 Left 1145810521 17:27761272-27761294 CCATGCGCAAACTGTACCAGCTG 0: 3
1: 1
2: 0
3: 9
4: 78
Right 1145810531 17:27761314-27761336 CTCCTTGGACGCCCCCACTCAGG 0: 4
1: 0
2: 0
3: 5
4: 117
1145810521_1145810533 29 Left 1145810521 17:27761272-27761294 CCATGCGCAAACTGTACCAGCTG 0: 3
1: 1
2: 0
3: 9
4: 78
Right 1145810533 17:27761324-27761346 GCCCCCACTCAGGCACTCTCAGG 0: 4
1: 0
2: 0
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145810521 Original CRISPR CAGCTGGTACAGTTTGCGCA TGG (reversed) Intronic
903898740 1:26626756-26626778 CAGCTTGTGCATTTTGGGCAGGG - Intergenic
906057936 1:42930656-42930678 CAGCTGGTGCAGGGTGCCCAGGG + Exonic
907267108 1:53269148-53269170 AAGCTGGTACAGTTGGAGCAAGG - Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907752910 1:57280899-57280921 CACCTGGTACACTTGGCACAAGG - Intronic
909927100 1:81450073-81450095 CAACTGGTTCACTTTGAGCATGG - Intronic
910052950 1:82997621-82997643 CAGCTGGGACAGTTTGACCAAGG - Intergenic
916571544 1:166032547-166032569 AACCTGGTACAGTTTCCTCAAGG + Intergenic
916835749 1:168543194-168543216 CAGCTGGTAGTGATTGCACATGG + Intronic
917502838 1:175601227-175601249 CAGCGGGTAGAGTTTGGGTAAGG + Intronic
921955549 1:220980046-220980068 CAGCAGGGACAGTATGCGTATGG - Intergenic
1067472760 10:46548395-46548417 CAGCTGGTGCAGTTTGTGGAAGG - Intergenic
1068253779 10:54480147-54480169 CAGCTATTACAGTTTGCTGATGG - Intronic
1069795445 10:71048970-71048992 CAGGTGGTACAATTTACACAGGG + Intergenic
1069911342 10:71761692-71761714 CAGCAGGGTCAGGTTGCGCATGG + Exonic
1071985009 10:91041420-91041442 CAGTTGGGACAGTTTCTGCAAGG + Intergenic
1078033950 11:7783018-7783040 CAGATGGTACATTTTTCTCATGG + Intergenic
1079321252 11:19453600-19453622 CAGATGGGGCAGTTTGGGCAAGG - Intronic
1093199839 12:16173221-16173243 CATCCTGTACAGTTTGCACAGGG + Intergenic
1093710235 12:22321423-22321445 CTGCTGCTTCAGTTTGGGCAGGG - Intronic
1100178069 12:92053232-92053254 CAACTGGAACAGTTTCCCCAGGG - Intronic
1101681867 12:106976170-106976192 CAGCCAGTACAGTTGGAGCAGGG - Intronic
1104750310 12:131234233-131234255 CAGGTGGTACAGATTGGGCATGG + Intergenic
1105417290 13:20224498-20224520 CAGCGGGTCCTGTTTGCGCCAGG + Intronic
1108429497 13:50339960-50339982 CAGCTGGTCCAGTTTGCTCGTGG - Intronic
1116581004 14:46641533-46641555 TAGCAGTTACAGTTTGCTCAAGG + Intergenic
1120544775 14:85797628-85797650 CAGCTGGTGAAGTTGGCACACGG - Intergenic
1121047064 14:90796073-90796095 CTGATGGTATAGTTTGTGCATGG - Intronic
1121282850 14:92711707-92711729 CAGGTGGTACTGCTTGTGCAGGG + Exonic
1121937794 14:98036554-98036576 CAGCTGGTACAGTTGACTGAGGG + Intergenic
1125527919 15:40390012-40390034 CAGCTGGCCCAGTATGTGCAGGG + Intronic
1129100687 15:73259909-73259931 CACCTGGTAGAGTTTGGGAATGG + Intronic
1130771837 15:86932058-86932080 TAGCTTGTACAGTTTACTCACGG + Intronic
1135158754 16:20075051-20075073 CAGCTGCTACAGTCTGCTCCTGG - Intergenic
1136257900 16:29054628-29054650 CAGAGGGTACAGTGTGGGCAAGG - Intergenic
1144892425 17:18501563-18501585 CAGCTGGTACAGTTTGCGCATGG - Intergenic
1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG + Intergenic
1145796071 17:27655953-27655975 CAGCTGGTACAGTTTGCACATGG - Intergenic
1145810521 17:27761272-27761294 CAGCTGGTACAGTTTGCGCATGG - Intronic
1146461733 17:33051317-33051339 CAGCTGGTTCAGTGTGCGGTAGG - Intronic
1146951230 17:36907983-36908005 CAGCTGGTACAGTACACCCAGGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1151121419 17:71797110-71797132 CAGATGGGAGAGTTTGTGCAGGG - Intergenic
1157634383 18:49136064-49136086 CTGCTGGTACAATTAGAGCAAGG + Intronic
1158651746 18:59294478-59294500 CAACTGGGACAGTTTGGGAAGGG + Intronic
1164685683 19:30165208-30165230 CAGGTGGTACAGTCTGCCCAGGG - Intergenic
1167234168 19:48303696-48303718 CAGCTGGGACAGTTTATTCAGGG + Exonic
1168639245 19:58019873-58019895 CAGCTGGGACACTCTGCACATGG - Intergenic
930704280 2:54488727-54488749 CAGATGGTACATTTTGTGTAGGG + Intronic
937065231 2:119012416-119012438 CATCTTCTACAGTTTGTGCATGG + Intergenic
938031399 2:127997516-127997538 CAGCTGGAGAAGTTTTCGCAGGG + Intronic
948668028 2:239548429-239548451 CAGAGGGTCCAGGTTGCGCATGG + Intergenic
1168849262 20:965424-965446 CAGATGGGACAGATTGCCCAGGG + Intronic
1175574003 20:60046816-60046838 CACCTGGTACAGTTTACACCAGG - Intergenic
949659748 3:6264851-6264873 CAGCTTGTTCAGTTTCCCCAAGG + Intergenic
949894623 3:8760042-8760064 CTGCAGGTCCAGTTGGCGCATGG - Intronic
957194196 3:77047019-77047041 CAGCTGGTACAATCTGGGAAGGG + Intronic
958015359 3:87934007-87934029 CAGCAGGAACAGTTTTCCCAGGG - Intergenic
966327131 3:178769436-178769458 AAGATGGTGCAGTTTGTGCAAGG + Intronic
968743467 4:2343712-2343734 CAGGTGGCACAGCTTGCCCAAGG + Intronic
968743475 4:2343759-2343781 CAGGTGGCACAGCTTGCCCAAGG + Intronic
969367193 4:6703373-6703395 CAGTTGGTGCAGTTTGAGCAGGG - Intergenic
971570466 4:28204941-28204963 CAGATGGTACAGCTTCCACATGG - Intergenic
973621892 4:52735169-52735191 CTGCTGGTAGAGGTTGGGCATGG - Intronic
976726021 4:88216475-88216497 ATGCTGGCACAGTTTGCACACGG - Intronic
980694538 4:136337788-136337810 CAATTGGTACAGTTGGCCCAGGG - Intergenic
983259901 4:165444221-165444243 CAGCTGTTAAACTTTGGGCAAGG - Intronic
983926224 4:173405674-173405696 AAGCTGGGACAGTTTGAGCAAGG - Intronic
991955928 5:71996082-71996104 CAGCTGGAAGACTTTGGGCAAGG - Intergenic
994300619 5:98142702-98142724 CAGCTGGGACAGAGTGAGCATGG - Intergenic
996692257 5:126352763-126352785 CAGCAGGTACAGCTGGCACATGG - Intergenic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1006410980 6:33873005-33873027 CAGCTGCCACAGTTTCTGCAGGG + Intergenic
1017658989 6:156655687-156655709 CAGCTGTTGCTGTTTGAGCACGG + Intergenic
1018293625 6:162319457-162319479 CAGCTATTATAGTTTGCACATGG - Intronic
1022580795 7:31552178-31552200 CAGCTGATACTTTTTGTGCAAGG + Intronic
1023507220 7:40912442-40912464 CAGCTGCTAAAGTTTTCCCATGG - Intergenic
1024918476 7:54530880-54530902 CAGCTGATGCAGTTTCCCCAGGG - Intergenic
1025023838 7:55499863-55499885 CAGAAGGTACTGTTTGTGCAGGG - Intronic
1035334013 7:158114112-158114134 CAGCTGGTCCAGTTTGGGAGTGG + Intronic
1041464527 8:58145647-58145669 CAGCTGGAAGAGTTCGCGCGTGG + Intronic
1048395782 8:134012645-134012667 CAGCAGGAACAGTGTGTGCAGGG + Intergenic
1048884051 8:138894368-138894390 CAGCTGGACCACTTTGCCCATGG - Intronic
1049921435 9:368485-368507 CAGTGTGTACAGTTTGTGCATGG - Intronic
1053034850 9:34816205-34816227 CAGCTGATCCAGTTTGCAAATGG + Intergenic
1055370234 9:75590607-75590629 CAGGTGATACAGTTGGCCCATGG - Intergenic
1057334974 9:94148450-94148472 CAGCTTGTTCAGTATGCGCTGGG + Intergenic
1058150364 9:101457150-101457172 CACCTGGGAGAGTTTGCTCAGGG + Intergenic
1059135227 9:111799682-111799704 CAGCTGAAACAATTTGAGCAGGG - Intergenic
1059611932 9:115907875-115907897 CAGCTGGTATAGTGTGCTGATGG - Intergenic
1062391282 9:136334921-136334943 CAGCAGTTACAGTTTGAGGAGGG + Intronic